?2908434 Summary - Canadian Patents Database (2025)

Note: Descriptions are shown in the official language in which they were submitted.

COMPOSITIONS AND METHODS FOR PERSONALIZED NEOPLASIA VACCINES
10
FIELD OF THE INVENTION
The present invention relates to personalized strategies for the treatment of
neoplasia.
More particularly, the present invention relates to the identification and use
of a patient specific
pool of tumor specific neo-antigens in a personalized tumor vaccine for
treatment of the subject.
BACKGROUND
Approximately 1,6 million Americans are diagnosed with neoplasia every year,
and
approximately 580,000 people in the United States are expected to die of the
disease in 2013.
Over the past few decades there been significant improvements in the
detection, diagnosis, and
treatment of neoplasia, which have significantly increased the survival rate
for many types of
neoplasia. However, only about 60% of people diagnosed with neoplasia are
still alive 5 years
after the onset of treatment, which makes neoplasia the second leading cause
of death in the
United States.
Currently, there are a number of different existing cancer therapies,
including ablation
techniques (e.g., surgical procedures, cryogenic/heat treatment, ultrasound,
radiofrequency, and
radiation) and chemical techniques (e.g., pharmaceutical agents,
cytotoxic/chemotherapeutic
agents, monoclonal antibodies, and various combinations thereof).
Unfortunately, such therapies
are frequently associated with serious risk, toxic side effects, and extremely
high costs, as well as
1
Date ecue/Date Received 2020-10-09

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
uncertain efficacy.
There is a growing interest in cancer therapies that seek to target cancerous
cells with a
patient's own immune system (e.g., cancer vaccines) because such therapies may
mitigate/eliminate some of the above-described disadvantages. Cancer vaccines
are typically
composed of tumor antigens and immunostimulatory molecules (e.g., cytokines or
TLR ligands)
that work together to induce antigen-specific cytotoxic T cells that target
and destroy tumor cells.
Current cancer vaccines typically contain shared tumor antigens, which are
native proteins (i.e. ¨
proteins encoded by the DNA of all the normal cells in the individual) that
are selectively
expressed or over-expressed in tumors found in many individuals. While such
shared tumor
antigens are useful in identifying particular types of tumors, they are not
ideal as immunogens
for targeting a T-cell response to a particular tumor type because they are
subject to the immune
dampening effects of self-tolerance. Accordingly, there is a need for methods
of identifying
more effective tumor antigens that may be used for neoplasia vaccines.
SUMMARY OF THE INVENTION
The present invention relates to a strategy for the personalized treatment of
neoplasia, and
more particularly to the identification and use of a personalized cancer
vaccine consisting
essentially of a pool of tumor-specific and patient-specific neo-antigens for
the treatment of
tumors in a subject. As described below, the present invention is based, at
least in part, on the
discovery that whole genome/exome sequencing may be used to identify all, or
nearly all,
mutated neo-antigens that are uniquely present in a neoplasia/tumor of an
individual patient, and
that this collection of mutated neo-antigens may be analyzed to identify a
specific, optimized
subset of neo-antigens for use as a personalized neoplasia vaccine for
treatment of the patient's
neoplasia/tumor.
In one aspect, the invention provides a method of making a personalized
neoplasia
vaccine for a subject diagnosed as having a neoplasia, which includes
identifying a plurality of
mutations in the neoplasia, analyzing the plurality of mutations to identify a
subset of at least
five neo-antigenic mutations predicted to encode neo-antigenic peptides, the
neo-antigenic
mutations selected from the group consisting of missense mutations, neo0RF
mutations, and any
combination thereof, and producing, based on the identified subset, a
personalized neoplasia
vaccine.
2

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
In an embodiment, the invention provides that the identifying step further
includes
sequencing the genome, transcriptome, or proteome of the neoplasia.
In another embodiment, the analyzing step may further include determining one
or more
characteristics associated with the subset of at least five neo-antigenic
mutations predicted to
encode neo-antigenic peptides, the characteristics selected from the group
consisting of
molecular weight, cysteine content, hydrophilicity, hydrophobicity, charge,
and binding affinity;
and ranking, based on the determined characteristics, each of the neo-
antigenic mutations within
the identified subset of at least five neo-antigenic mutations. In an
embodiment, the top 5-30
ranked neo-antigenic mutations are included in the personalized neoplasia
vaccine. In another
embodiment, the neo-antigenic mutations are ranked according to the order
shown in FIG. 8.
In one embodiment, the personalized neoplasia vaccine comprises at least about
20 neo-
antigenic peptides corresponding to the neo-antigenic mutations.
In another embodiment, the personalized neoplasia vaccine comprises one or
more DNA
molecules capable of expressing at least about 20 neo-antigenic peptides
corresponding to the
neo-antigenic mutations. In another embodiment, the personalized neoplasia
vaccine comprises
one or more RNA molecules capable of expressing at least 20 neo-antigenic
peptides
corresponding to the neo-antigenic mutations.
In embodiments, the personalized neoplasia vaccine comprises neo0RF mutations
predicted to encode a neo0RF polypeptide having a Kd of < 500 nM.
In another embodiment, the personalized neoplasia vaccine comprises missense
mutations predicted to encode a polypeptide having a Kd of < 150 nM, wherein
the native
cognate protein has a Kd of > 1000 nM or < 150 nM.
In another embodiment, the at least about 20 neo-antigenic peptides range from
about 5
to about 50 amino acids in length. In another embodiment, the at least about
20 neo-antigenic
peptides range from about 15 to about 35 amino acids in length. In another
embodiment, the at
least about 20 neo-antigenic peptides range from about 18 to about 30 amino
acids in length. In
another embodiment, the at least about 20 neo-antigenic peptides range from
about 6 to about 15
amino acids in length. In yet another embodiment, the at least about 20 neo-
antigenic peptides
are 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids in length.
In one embodiment, the personalized neoplasia vaccine further includes an
adjuvant. In
other embodiments, the adjuvant is selected from the group consisting of poly-
ICLC, 1018 ISS,
3

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
aluminum salts, Amplivax, AS15. BCG, CP-870,893, CpG7909, CyaA, dSLIM. GM-CSF,
IC30,
IC31, Imiquimod, ImuFact EVIP321, IS Patch, ISS, ISCOMATRIX, Juvlmmune,
LipoVac,
MF59, monophosphoryl lipid A, Montanide IMS 1312, Montanide ISA 206, Montanide
ISA
50V, Montanide ISA-51, OK-432, 0M-174, 0M-197-MP-EC, ONTAK, PepTel® vector
system. PLGA microparticles, resiquimod, 5RL172, Virosomes and other Virus-
like particles,
YF-17D, VEGF trap, R848, beta-glucan, Pam3Cys, Aquila's Q521 stimulon.
vadimezan, and/or
AsA404 (DMXAA). In a preferred embodiment, the adjuvant is poly-ICLC.
In another aspect, the invention includes a method of treating a subject
diagnosed as
having a neoplasia with a personalized neoplasia vaccine, which includes
identifying a plurality
of mutations in the neoplasia; analyzing the plurality of mutations to
identify a subset of at least
five neo-antigenic mutations predicted to encode expressed neo-antigenic
peptides, the neo-
antigenic mutations selected from the group consisting of missense mutations,
neo0RF
mutations, and any combination thereof; producing, based on the identified
subset, a
personalized neoplasia vaccine; and administering the personalized neoplasia
vaccine to the
subject, thereby treating the neoplasia.
In another embodiment, the identifying step may further include sequencing the
genome,
transcriptome, or proteome of the neoplasia.
In yet another embodiment, the analyzing step may further include determining
one or
more characteristics associated with the subset of at least five neo-antigenic
mutations predicted
to encode expressed neo-antigenic peptides, the characteristics selected from
the group
consisting of molecular weight, cysteine content, hydrophilicity,
hydrophobicity charge, and
binding affinity; and ranking, based on the determined characteristics, each
of the neo-antigenic
mutations within the identified subset of at least five neo-antigenic
mutations.
In one embodiment, the top 5-30 ranked neo-antigenic mutations are included in
the
personalized neoplasia vaccine. In another embodiment, the neo-antigenic
mutations are ranked
according to the order shown in FIG. 8.
In one embodiment, the personalized neoplasia vaccine comprises at least 20
neo-
antigenic peptides corresponding to the neo-antigenic mutations.
In another embodiment, the personalized neoplasia vaccine comprises one or
more DNA
molecules capable of expressing at least 20 neo-antigenic peptides
corresponding to the neo-
antigenic mutations.
4

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
In one embodiment, the personalized neoplasia vaccine comprises one or more
RNA
molecules capable of expressing at least 20 neo-antigenic peptides
corresponding to the neo-
antigenic mutations.
In one embodiment, the personalized neoplasia vaccine comprises neo0RF
mutations
predicted to encode a neo0RF polypeptide having a Kd of < 500 nM.
In another embodiment, the personalized neoplasia vaccine comprises missense
mutations predicted to encode a polypeptide having a Kd of < 150 nM, wherein
the native
cognate protein has a Kd of? 1000 nM or < 150 nM.
In one embodiment, the at least 20 neo-antigenic peptides range from about 5
to about 50
amino acids in length. In one embodiment, the at least 20 neo-antigenic
peptides range from
about 15 to about 35 amino acids in length. In one embodiment, the at least 20
neo-antigenic
peptides range from about 18 to about 30 amino acids in length. In one
embodiment, the at least
neo-antigenic peptides range from about 6 to about 15 amino acids in length.
In one
embodiment, the at least 20 neo-antigenic peptides are 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, or
15 25 amino acids in length.
In one embodiment, the administering further includes dividing the produced
vaccine into
two or more sub-pools; and injecting each of the sub-pools into a different
location of the patient.
In one embodiment, each of the sub-pools injected into a different location
comprises neo-
antigenic peptides such that the number of individual peptides in the sub-pool
targeting any
20 single patient HLA is one, or as few above one as possible.
In one embodiment, the administering step further includes dividing the
produced vaccine
into two or more sub-pools, wherein each sub-pool comprises at least five neo-
antigenic peptides
selected to optimize intra-pool interactions.
In one embodiment, optimizing comprises reducing negative interaction among
the neo-
antigenic peptides in the same pool.
In another aspect, the invention includes a personalize neoplasia vaccine
prepared
according to the above-described methods.
Definitions
To facilitate an understanding of the present invention, a number of terms and
phrases are
defined below:
5

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Unless specifically stated or obvious from context, as used herein, the term
"about" is
understood as within a range of normal tolerance in the art, for example
within 2 standard
deviations of the mean. About can be understood as within 50%, 45%, 40%, 35%,
30%, 25%,
20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01%
of the
stated value. Unless otherwise clear from context, all numerical values
provided herein are
modified by the term about.
By "agent" is meant any small molecule chemical compound, antibody, nucleic
acid
molecule, or polypeptide, or fragments thereof.
By "ameliorate" is meant decrease, suppress, attenuate, diminish, arrest, or
stabilize the
development or progression of a disease (e.g., a neoplasia, tumor, etc.).
By "alteration" is meant a change (increase or decrease) in the expression
levels or
activity of a gene or polypeptide as detected by standard art known methods
such as those
described herein. As used herein, an alteration includes a 10% change in
expression levels,
preferably a 25% change, more preferably a 40% change, and most preferably a
50% or greater
change in expression levels.
By "analog" is meant a molecule that is not identical, but has analogous
functional or
structural features. For example, a tumor specific neo-antigen polypeptide
analog retains the
biological activity of a corresponding naturally-occurring tumor specific neo-
antigen
polypeptide, while having certain biochemical modifications that enhance the
analog's function
relative to a naturally-occurring polypeptide. Such biochemical modifications
could increase the
analog's protease resistance, membrane permeability, or half-life, without
altering, for example,
ligand binding. An analog may include an unnatural amino acid.
The phrase "combination therapy" embraces the administration of a pooled
sample of
neoplasia/tumor specific neo-antigens and one or more additional therapeutic
agents as part of a
specific treatment regimen intended to provide a beneficial (additive or
synergistic) effect from
the co-action of these therapeutic agents. The beneficial effect of the
combination includes, but
is not limited to, pharmacokinetic or pharmacodynamic co-action resulting from
the combination
of therapeutic agents. Administration of these therapeutic agents in
combination typically is
carried out over a defined time period (usually minutes, hours, days, or weeks
depending upon
the combination selected). "Combination therapy" is intended to embrace
administration of
these therapeutic agents in a sequential manner, that is, wherein each
therapeutic agent is
6

CA 02908434 2015-09-30
WO 2014/168874 PCT/1JS2014/033185
administered at a different time, as well as administration of these
therapeutic agents, or at least
two of the therapeutic agents, in a substantially simultaneous manner.
Substantially
simultaneous administration can be accomplished, for example, by administering
to the subject a
single capsule having a fixed ratio of each therapeutic agent or in multiple,
single capsules for
each of the therapeutic agents. For example, one combination of the present
invention may
comprise a pooled sample of tumor specific neo-antigens and at least one
additional therapeutic
agent (e.g., a chemotherapeutic agent, an anti-angiogenesis agent, an
immunosuppressive agent,
an anti-inflammatory agent, and the like) at the same or different times or
they can be formulated
as a single, co-formulated pharmaceutical composition comprising the two
compounds. As
another example, a combination of the present invention (e.g., a pooled sample
of tumor specific
neo-antigens and at least one additional therapeutic agent) may be formulated
as separate
pharmaceutical compositions that can be administered at the same or different
time. Sequential
or substantially simultaneous administration of each therapeutic agent can be
effected by any
appropriate route including, but not limited to, oral routes, intravenous
routes, sub-cutaneous
routes, intramuscular routes, direct absorption through mucous membrane
tissues (e.g., nasal,
mouth, vaginal, and rectal), and ocular routes (e.g., intravitreal,
intraocular, etc.). The
therapeutic agents can be administered by the same route or by different
routes. For example,
one component of a particular combination may be administered by intravenous
injection while
the other component(s) of the combination may be administered orally. The
components may be
administered in any therapeutically effective sequence.
The phrase "combination" embraces groups of compounds or non-drug therapies
useful
as part of a combination therapy.
In this disclosure, "comprises," "comprising," "containing" and "having" and
the like can
have the meaning ascribed to them in U.S. Patent law and can mean "includes,"
"including," and
the like; "consisting essentially of' or "consists essentially" likewise has
the meaning ascribed in
U.S. Patent law and the term is open-ended, allowing for the presence of more
than that which is
recited so long as basic or novel characteristics of that which is recited is
not changed by the
presence of more than that which is recited, but excludes prior art
embodiments.
By "control" is meant a standard or reference condition.
By "disease" is meant any condition or disorder that damages or interferes
with the
normal function of a cell, tissue, or organ.
7

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
By "effective amount" is meant the amount required to ameliorate the symptoms
of a
disease (e.g., a neoplasia/tumor) relative to an untreated patient. The
effective amount of active
compound(s) used to practice the present invention for therapeutic treatment
of a disease varies
depending upon the manner of administration, the age, body weight. and general
health of the
subject. Ultimately, the attending physician or veterinarian will decide the
appropriate amount
and dosage regimen. Such amount is referred to as an "effective" amount.
By "fragment" is meant a portion of a polypeptide or nucleic acid molecule.
This portion
contains, preferably, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%. or
90% of the
entire length of the reference nucleic acid molecule or polypeptide. A
fragment may contain 5,
10, 20, 30, 40, 50, 60, 70, 80, 90, or 100. 200, 300, 400, 500, 600, 700, 800,
900, 1000 or more
nucleotides or amino acids.
"Hybridization" means hydrogen bonding, which may be Watson-Crick, Hoogsteen
or
reversed Hoogsteen hydrogen bonding, between complementary nucleobases. For
example,
adenine and thymine are complementary nucleobases that pair through the
formation of
hydrogen bonds.
By "inhibitory nucleic acid" is meant a double-stranded RNA, siRNA, shRNA, or
antisense RNA, or a portion thereof, or a mimetic thereof, that when
administered to a
mammalian cell results in a decrease (e.g., by 10%, 25%, 50%, 75%, or even 90-
100%) in the
expression of a target gene. Typically, a nucleic acid inhibitor comprises at
least a portion of a
target nucleic acid molecule, or an ortholog thereof, or comprises at least a
portion of the
complementary strand of a target nucleic acid molecule. For example, an
inhibitory nucleic acid
molecule comprises at least a portion of any or all of the nucleic acids
delineated herein.
By "isolated polynucleotide" is meant a nucleic acid (e.g.. a DNA) that is
free of the
genes which, in the naturally-occurring genome of the organism-or in the
genomic DNA of a
neoplasia/tumor derived from the organism-the nucleic acid molecule of the
invention is
derived. The term therefore includes, for example, a recombinant DNA (e.g.,
DNA coding for a
neo0RF, read-through, or InDel derived polypeptide identified in a patient's
tumor) that is
incorporated into a vector; into an autonomously replicating plasmid or virus;
or into the
genomic DNA of a prokaryote or eukaryote; or that exists as a separate
molecule (for example, a
cDNA or a genomic or cDNA fragment produced by PCR or restriction endonuclease
digestion)
independent of other sequences. In addition, the term includes an RNA molecule
that is
8

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
transcribed from a DNA molecule, as well as a recombinant DNA that is part of
a hybrid gene
encoding additional polypeptide sequence.
By an "isolated polypeptide" is meant a polypeptide of the invention that has
been
separated from components that naturally accompany it. Typically, the
polypeptide is isolated
.. when it is at least 60%, by weight, free from the proteins and naturally-
occurring organic
molecules with which it is naturally associated. Preferably, the preparation
is at least 75%, more
preferably at least 90%, and most preferably at least 99%, by weight, a
polypeptide of the
invention. An isolated polypeptide of the invention may be obtained, for
example, by extraction
from a natural source, by expression of a recombinant nucleic acid encoding
such a polypeptide;
.. or by chemically synthesizing the protein. Purity can be measured by any
appropriate method,
for example, column chromatography, polyacrylamide gel electrophoresis, or by
HPLC analysis.
A "ligand7 is to be understood as meaning a molecule which has a structure
complementary to that of a receptor and is capable of forming a complex with
the receptor.
According to the invention, a ligand is to be understood as meaning a peptide
or peptide
fragment that has a suitable length and suitable binding motifs in its amino
acid sequence, so that
the peptide or peptide fragment is capable of forming a complex with proteins
of MHC class I or
MHC class II.
"Mutation" for the purposes of this document means a DNA sequence found in the
tumor
DNA sample of a patient that is not found in the corresponding normal DNA
sample of that same
.. patient. "Mutation" may also refer to patterns in the sequence of RNA from
a patient that are not
attributable to expected variations based on known information for an
individual gene and are
reasonably considered to be novel variations in, for example, the splicing
pattern of one or more
genes that has been specifically altered in the tumor cells of the patient.
"Neo-antigen" or "neo-antigenic" means a class of tumor antigens that arises
from a
tumor-specific mutation(s) which alters the amino acid sequence of genome
encoded proteins.
By "neoplasia" is meant any disease that is caused by or results in
inappropriately high
levels of cell division, inappropriately low levels of apoptosis, or both. For
example, cancer is an
example of a neoplasia. Examples of cancers include, without limitation,
leukemia (e.g., acute
leukemia, acute lymphocytic leukemia, acute myelocytic leukemia, acute
myeloblastic leukemia,
.. acute promyelocytic leukemia, acute myelomonocytic leukemia, acute
monocytic leukemia,
acute erythroleukemia, chronic leukemia, chronic myelocytic leukemia, chronic
lymphocytic
9

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
leukemia), polycythemia vera, lymphoma (e.g., Hodgkin's disease, non-Hodgkin's
disease),
Waldenstrom's macroglobulinemia, heavy chain disease, and solid tumors such as
sarcomas and
carcinomas (e.g., fibrosarcoma. myxosarcoma, liposarcoma, chondrosarcoma,
osteogenic
sarcoma, chordoma, angiosarcoma, endotheliosarcoma. lymphangiosarcoma,
lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor,
leiomyosarcoma,
rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian
cancer, prostate
cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat
gland carcinoma,
sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas,
cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell
carcinoma,
hepatoma, nile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma,
Wilm's
tumor, cervical cancer, uterine cancer, testicular cancer, lung carcinoma,
small cell lung
carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma,
medulloblastoma,
craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma,
oligodenroglioma, schwannoma, meningioma, melanoma, neuroblastoma, and
retinoblastoma).
Lymphoproliferative disorders are also considered to be proliferative
diseases.
Unless specifically stated or obvious from context, as used herein, the term
"or" is
understood to be inclusive. Unless specifically stated or obvious from
context, as used herein,
the terms "a." "an," and "the" are understood to be singular or plural.
The term "patient" or "subject" refers to an animal which is the object of
treatment,
observation, or experiment. By way of example only, a subject includes, but is
not limited to, a
mammal, including, but not limited to, a human or a non-human mammal, such as
a non-human
primate, bovine, equine, canine, ovine, or feline.
"Pharmaceutically acceptable" refers to approved or approvable by a regulatory
agency
of the Federal or a state government or listed in the U.S. Pharmacopeia or
other generally
recognized pharmacopeia for use in animals, including humans.
"Pharmaceutically acceptable excipient, carrier or diluent" refers to an
excipient, carrier
or diluent that can be administered to a subject, together with an agent, and
which does not
destroy the pharmacological activity thereof and is nontoxic when administered
in doses
sufficient to deliver a therapeutic amount of the agent.

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
A "pharmaceutically acceptable salt" of pooled tumor specific neo-antigens as
recited
herein may be an acid or base salt that is generally considered in the art to
be suitable for use in
contact with the tissues of human beings or animals without excessive
toxicity, irritation, allergic
response, or other problem or complication. Such salts include mineral and
organic acid salts of
basic residues such as amines, as well as alkali or organic salts of acidic
residues such as
carboxylic acids. Specific pharmaceutical salts include, but are not limited
to, salts of acids such
as hydrochloric, phosphoric, hydrobromic. malic, glycolic, fumaric, sulfuric,
sulfamic, sulfanilic,
formic, toluenesulfonic, methanesulfonic, benzene sulfonic, ethane disulfonic,
2-
hydroxyethylsulfonic, nitric, benzoic, 2-acetoxybenzoic, citric, tartaric,
lactic, stearic, salicylic,
glutamic, ascorbic, pamoic, succinic, fumaric, maleic, propionic,
hydroxymaleic, hydroiodic,
phenylacetic, alkanoic such as acetic, HOOC-(CH2)õ-COOH where n is 0-4, and
the like.
Similarly, pharmaceutically acceptable cations include, but are not limited to
sodium, potassium,
calcium, aluminum, lithium and ammonium. Those of ordinary skill in the art
will recognize
further pharmaceutically acceptable salts for the pooled tumor specific neo-
antigens provided
herein, including those listed by Remington's Pharmaceutical Sciences, 17th
ed., Mack
Publishing Company, Easton, PA, p. 1418 (1985). In general, a pharmaceutically
acceptable
acid or base salt can be synthesized from a parent compound that contains a
basic or acidic
moiety by any conventional chemical method. Briefly, such salts can be
prepared by reacting the
free acid or base forms of these compounds with a stoichiometric amount of the
appropriate base
or acid in an appropriate solvent.
As used herein, the terms "prevent," "preventing," "prevention," "prophylactic
treatment." and the like, refer to reducing the probability of developing a
disease or condition in
a subject, who does not have, but is at risk of or susceptible to developing a
disease or condition.
"Primer set" means a set of oligonucleotides that may be used, for example,
for PCR. A
primer set would consist of at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 30,
40, 50, 60, 80, 100, 200,
250, 300, 400, 500, 600, or more primers.
-Proteins or molecules of the major histocompatibility complex (MHC)," -MHC
molecules," -MHC proteins" or -HLA proteins" are to be understood as meaning,
in particular,
proteins capable of binding peptides resulting from the proteolytic cleavage
of protein antigens
and representing potential T-cell epitopes, transporting them to the cell
surface and presenting
11

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
them to specific cells there, in particular naive T-cells, cytotoxic T-
lymphocytes or T-helper
cells. The major histocompatibility complex in the genome comprises the
genetic region whose
gene products are expressed on the cell surface and are important for binding
and presenting
endogenous and/or foreign antigens, and thus for regulating immunological
processes. The
major histocompatibility complex is classified into two gene groups coding for
different proteins:
molecules of MHC class I and MHC class II. The molecules of the two MHC
classes are
specialized for different antigen sources. The molecules of MHC class I
typically present but are
not restricted to endogenously synthesized antigens, for example viral
proteins and tumor
antigens. The molecules of MHC class II present protein antigens originating
from exogenous
sources, for example bacterial products. The cellular biology and the
expression patterns of the
two MHC classes are adapted to these different roles.
MHC molecules of class I consist of a heavy chain and a light chain and are
capable of
binding a peptide of about 8 to 11 amino acids, but usually 9 or 10 amino
acids, if this peptide
has suitable binding motifs, and presenting it to naïve and cytotoxic T-
lymphocytes. The
peptide bound by the MHC molecules of class I typically but not exclusively
originates from an
endogenous protein antigen. The heavy chain of the MHC molecules of class I is
preferably an
HLA-A. HLA-B or HLA-C monomer, and the light chain is 3-2-microglobulin.
MHC molecules of class II consist of an a-chain and a fl-chain and are capable
of binding
a peptide of about 15 to 24 amino acids if this peptide has suitable binding
motifs, and presenting
it to T-helper cells. The peptide bound by the MHC molecules of class II
usually originates from
an extracellular or exogenous protein antigen. The a-chain and the 3-chain are
in particular
HLA-DR. HLA-DQ and HLA-DP monomers.
Ranges provided herein are understood to be shorthand for all of the values
within the
range. For example, a range of 1 to 50 is understood to include any number,
combination of
numbers, or sub-range from the group consisting of 1, 2, 3, 4, 5, 6. 7, 8, 9,
10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,
35, 36, 37, 38, 39, 40, 41,
42, 43, 44, 45. 46, 47, 48, 49, or 50, as well as all intervening decimal
values between the
aforementioned integers such as, for example. 1.1, 1.2, 1.3, 1.4, 1.5, 1.6,
1.7, 1.8. and 1.9. With
respect to sub-ranges, "nested sub-ranges" that extend from either end point
of the range are
specifically contemplated. For example, a nested sub-range of an exemplary
range of 1 to 50
12

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
may comprise' to 10, 1 to 20, 1 to 30, and 1 to 40 in one direction. or 50 to
40, 50 to 30, 50 to
20, and 50 to 10 in the other direction.
A "receptor" is to be understood as meaning a biological molecule or a
molecule
grouping capable of binding a ligand. A receptor may serve, to transmit
information in a cell, a
cell formation or an organism. The receptor comprises at least one receptor
unit and frequently
contains two or more receptor units, where each receptor unit may consist of a
protein molecule,
in particular a glycoprotein molecule. The receptor has a structure that
complements the
structure of a ligand and may complex the ligand as a binding partner.
Signaling information
may be transmitted by conformational changes of the receptor following binding
with the ligand
on the surface of a cell. According to the invention, a receptor may refer to
particular proteins of
MHC classes I and II capable of forming a receptor/ligand complex with a
ligand, in particular a
peptide or peptide fragment of suitable length.
A "receptor/ligand complex" is also to be understood as meaning a
"receptor/peptide
complex" or -receptor/peptide fragment complex," in particular a peptide- or
peptide fragment-
presenting MHC molecule of class I or of class II.
By "reduces" is meant a negative alteration of at least 10%, 25%, 50%, 75%, or
100%.
By -reference" is meant a standard or control condition.
A "reference sequence" is a defined sequence used as a basis for sequence
comparison.
A reference sequence may be a subset of, or the entirety of, a specified
sequence; for example, a
segment of a full-length cDNA or genomic sequence, or the complete cDNA or
genomic
sequence. For polypeptides, the length of the reference polypeptide sequence
will generally be at
least about 10-2,000 amino acids, 10-1,500, 10-1,000, 10-500, or 10-100.
Preferably, the length
of the reference polypeptide sequence may be at least about 10-50 amino acids,
more preferably
at least about 10-40 amino acids, and even more preferably about 10-30 amino
acids, about 10-
20 amino acids, about 15-25 amino acids, or about 20 amino acids. For nucleic
acids, the length
of the reference nucleic acid sequence will generally be at least about 50
nucleotides, preferably
at least about 60 nucleotides, more preferably at least about 75 nucleotides,
and even more
preferably about 100 nucleotides or about 300 nucleotides or any integer
thereabout or there
between.
13

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
By "specifically binds" is meant a compound or antibody that recognizes and
binds a
polypeptide of the invention, but which does not substantially recognize and
bind other
molecules in a sample, for example, a biological sample.
Nucleic acid molecules useful in the methods of the invention include any
nucleic acid
molecule that encodes a polypeptide of the invention or a fragment thereof.
Such nucleic acid
molecules need not be 100% identical with an endogenous nucleic acid sequence,
but will
typically exhibit substantial identity. Polynucleotides having "substantial
identity" to an
endogenous sequence are typically capable of hybridizing with at least one
strand of a double-
stranded nucleic acid molecule. . By "hybridize" is meant pair to form a
double-stranded
molecule between complementary polynucleotide sequences (e.g., a gene
described herein), or
portions thereof, under various conditions of stringency. (See, e.g., Wahl, G.
M. and S. L. Berger
(1987) Methods Enzymol. 152:399; Kimmel, A. R. (1987) Methods Enzymol.
152:507).
For example, stringent salt concentration will ordinarily be less than about
750 mM NaC1
and 75 mM trisodium citrate, preferably less than about 500 mM NaCl and 50 mM
trisodium
citrate, and more preferably less than about 250 mM NaCl and 25 mM trisodium
citrate. Low
stringency hybridization can be obtained in the absence of organic solvent,
e.g., formamide,
while high stringency hybridization can be obtained in the presence of at
least about 35%
formamide, and more preferably at least about 50% formamide. Stringent
temperature conditions
will ordinarily include temperatures of at least about 30 C, more preferably
of at least about
37 C, and most preferably of at least about 42 C. Varying additional
parameters, such as
hybridization time, the concentration of detergent, e.g., sodium dodecyl
sulfate (SDS), and the
inclusion or exclusion of carrier DNA, are well known to those skilled in the
art. Various levels
of stringency are accomplished by combining these various conditions as
needed. In a preferred:
embodiment, hybridization will occur at 30 C in 750 mM NaCl, 75 mM trisodium
citrate, and
1% SDS. In a more preferred embodiment, hybridization will occur at 37 C in
500 mM NaCl,
50 mM trisodium citrate, 1% SDS, 35% formamide, and 100 1..tg/m1 denatured
salmon sperm
DNA (ssDNA). In a most preferred embodiment, hybridization will occur at 42 C
in 250 mM
NaCl, 25 mM trisodium citrate. 1% SDS, 50% formamide, and 200 mg/m1 ssDNA.
Useful
variations on these conditions will be readily apparent to those skilled in
the art.
For most applications, washing steps that follow hybridization will also vary
in
stringency. Wash stringency conditions can be defined by salt concentration
and by temperature.
14

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
As above, wash stringency can be increased by decreasing salt concentration or
by increasing
temperature. For example, stringent salt concentration for the wash steps will
preferably be less
than about 30 mM NaCl and 3 mM trisodium citrate, and most preferably less
than about 15 mM
NaCl and 1.5 mM trisodium citrate. Stringent temperature conditions for the
wash steps will
ordinarily include a temperature of at least about 25 C, more preferably of at
least about 42 C,
and even more preferably of at least about 68 C. In a preferred embodiment,
wash steps will
occur at 25 C in 30 mM NaCl, 3 mM trisodium citrate, and 0.1% SDS. In a more
preferred
embodiment, wash steps will occur at 42 C in 15 mM NaCl, 1.5 mM trisodium
citrate, and 0.1%
SDS. In a more preferred embodiment, wash steps will occur at 68 C in 15 mM
NaCl, 1.5 mM
trisodium citrate, and 0.1% SDS. Additional variations on these conditions
will be readily
apparent to those skilled in the art. Hybridization techniques are well known
to those skilled in
the art and are described, for example. in Benton and Davis (Science 196:180,
1977); Grunstein
and Hogness (Proc. Natl. Acad. Sci., USA 72:3961, 1975); Ausubel et al.
(Current Protocols in
Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel
(Guide to
Molecular Cloning Techniques, 1987, Academic Press, New York); and Sambrook
etal.,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press,
New York.
By "substantially identical" is meant a polypeptide or nucleic acid molecule
exhibiting at
least 50% identity to a reference amino acid sequence (for example, any one of
the amino acid
sequences described herein) or nucleic acid sequence (for example, any one of
the nucleic acid
sequences described herein). Preferably, such a sequence is at least 60%, more
preferably 80%
or 85%, and more preferably 90%, 95% or even 99% identical at the amino acid
level or nucleic
acid to the sequence used for comparison.
Sequence identity is typically measured using sequence analysis software (for
example,
Sequence Analysis Software Package of the Genetics Computer Group, University
of Wisconsin
Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, BLAST,
BESTFIT,
GAP, or PILEUP/PRETTYBOX programs). Such software matches identical or similar
sequences by assigning degrees of homology to various substitutions,
deletions, and/or other
modifications. Conservative substitutions typically include substitutions
within the following
groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic
acid, asparagine,
glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.
In an exemplary

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
approach to determining the degree of identity, a BLAST program may be used,
with a
probability score between e-'3 and e-100 indicating a closely related
sequence.
A "T-cell epitope" is to be understood as meaning a peptide sequence that can
be bound
by MHC molecules of class I or II in the form of a peptide-presenting MHC
molecule or MHC
complex and then, in this form, be recognized and bound by naïve T-cells,
cytotoxic T-
lymphocytes or T-helper cells.
As used herein, the terms "treat," "treated," "treating," "treatment," and the
like refer to
reducing or ameliorating a disorder and/or symptoms associated therewith
(e.g., a neoplasia or
tumor). It will be appreciated that, although not precluded, treating a
disorder or condition does
not require that the disorder, condition, or symptoms associated therewith be
completely
eliminated.
The term "therapeutic effect" refers to some extent of relief of one or more
of the
symptoms of a disorder (e.g., a neoplasia or tumor) or its associated
pathology. -Therapeutically
effective amount" as used herein refers to an amount of an agent which is
effective, upon single
or multiple dose administration to the cell or subject, in prolonging the
survivability of the
patient with such a disorder, reducing one or more signs or symptoms of the
disorder, preventing
or delaying, and the like beyond that expected in the absence of such
treatment.
"Therapeutically effective amount" is intended to qualify the amount required
to achieve a
therapeutic effect. A physician or veterinarian having ordinary skill in the
art can readily
.. determine and prescribe the "therapeutically effective amount" (e.g., ED50)
of the
pharmaceutical composition required. For example, the physician or
veterinarian could start
doses of the compounds of the invention employed in a pharmaceutical
composition at levels
lower than that required in order to achieve the desired therapeutic effect
and gradually increase
the dosage until the desired effect is achieved.
The pharmaceutical compositions typically should provide a dosage of from
about 0.0001
mg to about 200 mg of compound per kilogram of body weight per day. For
example, dosages
for systemic administration to a human patient can range from 0.01-10 ug/kg,
20-80 ug/kg. 5-50
ug/kg, 75-150 ug/kg, 100-500 ug/kg, 250-750 ug/kg, 500-1000 ug/kg, 1-10 mg/kg,
5-50 mg/kg,
25-75 mg/kg, 50-100 mg/kg, 100-250 mg/kg, 50-100 mg/kg, 250-500 mg/kg, 500-750
mg/kg.
750-1000 mg/kg, 1000-1500 mg/kg, 1500-2000 mg/kg. 5 mg/kg, 20 mg/kg, 50 mg/kg,
100
mg/kg, of 200 mg/kg. Pharmaceutical dosage unit forms are prepared to provide
from about
16

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
0.001 mg to about 5000 mg, for example from about 100 to about 2500 mg of the
compound or a
combination of essential ingredients per dosage unit form.
A "vaccine" is to be understood as meaning a composition for generating
immunity for
the prophylaxis and/or treatment of diseases (e.g., neoplasia/tumor).
Accordingly, vaccines are
medicaments which comprise antigens and are intended to be used in humans or
animals for
generating specific defense and protective substance by vaccination.
The recitation of a listing of chemical groups in any definition of a variable
herein
includes definitions of that variable as any single group or combination of
listed groups. The
recitation of an embodiment for a variable or aspect herein includes that
embodiment as any
single embodiment or in combination with any other embodiments or portions
thereof.
Any compositions or methods provided herein can be combined with one or more
of any
of the other compositions and methods provided herein.
BRIEF DESCRIPTION OF THE DRAWINGS
The above-mentioned and other features and advantages of the present
disclosure will be
better understood when reading the following detailed description taken
together with the
following drawings in which:
Figure 1 depicts a flow process for making a personalized cancer vaccine
according to an
exemplary embodiment of the invention.
Figure 2 shows a flow process for pre-treatment steps for generating a cancer
vaccine for
a melanoma patient according to an exemplary embodiment of the invention.
Figure 3 is a flowchart depicting an approach for addressing an initial
patient population
study according to an exemplary embodiment of the invention. Five patients may
be treated in
the first cohort at an anticipated safe dose level. If fewer than two of these
five patients develop
a dose limiting toxicity at, or prior to, the primary safety endpoint, then 10
more patients may be
recruited at that dose level to expand the analysis of the patient population
(e.g., to assess
efficacy, safety, etc.). If two or more dose limiting toxicities (DLTs) are
observed, then the dose
of poly-ICLC may be reduced by 50% and five additional patients may be
treated. If fewer than
two of these five patients develop a dose limiting toxicity, then 10 more
patients may be
recruited at that dose level. However, if two or more patients at the reduced
poly-ICLC level
develop a DLT, then the study will be stopped.
17

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Figures 4A and 4B show examples of different types of discrete mutations and
neo0RFs,
respectively.
Figure 5 illustrates an immunization schedule based on a prime boost strategy
according
to an exemplary embodiment of the present invention. Multiple immunizations
may occur over
the first ¨3 weeks to maintain an early high antigen exposure during the
priming phase of
immune response. Patients may then be rested for eight weeks to allow memory T
cells to
develop and these T cells will then be boosted in order to maintain a strong
ongoing response.
Figure 6 shows a time line indicating the primary immunological endpoint
according to
an exemplary aspect of the invention.
Figure 7 illustrates a time line for administering a co-therapy with
checkpoint blockade
antibodies to evaluate the combination of relief of local immune suppression
coupled with the
stimulation of new immunity according to an exemplary embodiment of the
invention. As
shown in the scheme, patients who enter as appropriate candidates for
checkpoint blockade
therapy, e.g., anti-PDL1 as shown here, may be entered and immediately treated
with antibody,
while the vaccine is being prepared. Patients may then be vaccinated.
Checkpoint blockade
antibody dosing can be continued or possibly deferred while the priming phase
of vaccination
occurs.
Figure 8 is a table that shows the ranking assignments for different neo-
antigenic
mutations according to an exemplary embodiment of the invention.
Figure 9 shows a schematic depicting drug product processing of individual neo-
antigenic peptides into pools of 4 subgroups according to an exemplary
embodiment of the
invention.
Figure 10 shows a schematic representation of a strategy to systematically
discover tumor
neoantigens according to an exemplary embodiment of the invention. Tumor
specific mutations
in cancer samples may be detected using whole-exome (WES) or whole-genome
sequencing
(WGS) and identified through the application of mutation calling algorithms
(e.g., Mutect).
Subsequently, candidate neoepitopes may be predicted using well-validated
algorithms (e.g.,
NetMHCpan) and their identification may be refined by experimental validation
for peptide-
HLA binding and by confirmation of gene expression at the RNA level. These
candidate
neoantigens may be subsequently tested for their ability to stimulate tumor-
specific T cell
responses.
18

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Figures 11A-C show the frequency of classes of point mutations that have the
potential to
generate neoantigens in chronic lymphocytic leukemia (CLL). Analysis of WES
and WGS data
generated from 91 CLL cases reveals that (A) missense mutations are the most
frequent class of
the somatic alterations with the potential to generate neo-epitopes, while (B)
frameshift
insertions and deletions and (C) splice-site mutations constitute less common
events.
Figures 12A-D depict the application of the NetMHCpan prediction algorithm to
functionally-defined neoepitopes and CLL cases. FIG. 12 A shows the predicted
binding (IC50)
to their known restricting HLA allele of 33 functionally identified cancer
neoepitopes reported in
literature tested by NetMHCpan, sorted on the basis of predicted binding
affinity. FIG. 12B
shows the distribution of the number of predicted peptides with HLA binding
affinity < 150 nM
(black) and 150-500 nM (grey) across 31 CLL patients with available HLA typing
information.
FIG. 12C shows a graph comparing the predicted binding (IC50 < 500 nM by
NetMHCpan) of
peptides from 4 patients with the experimentally determined binding affinity
for HLA-A and -B
allele binding using a competitive MHC I allele-binding assay with synthesized
peptides. The
percent of predicted peptides with evidence of experimental binding (IC50 <
500 nM) are
indicated. FIG. 12D shows that from 26 CLL patients for which HLA typing and
Affymetrix
U133 2.0+ gene expression data were available, the distribution of gene
expression was
examined for all somatically mutated genes (n=347), and for the subset of gene
mutations
encoding neoepitopes with predicted HLA binding scores of IC50 < 500 nM
(n=180). No-low:
genes within the lowest quartile expression; medium: genes within the 2 middle
quartiles of
expression; and high: genes within the highest quartile of expression.
Figures 13A-B show the same data as in Figure 12D but separately for 9-mer
(FIG. 13A)
and 10-mer peptides (FIG. 13B). In each case, percentages of peptides with
predicted 1E50 <
150 nM and 150-500 nM, with evidence of experimental binding are indicated.
Figures 14A-C depict that mutations in ALMS] and COORF89 in Pt 1 generate
immunogenic peptides. FIG. 14A shows that 25 missense mutations were
identified in Pt 1 CLL
cells from which 30 peptides from 13 mutations were predicted to bind to Pt
l's MfIC class I
alleles. A total of 14 peptides from 9 mutations were experimentally confirmed
as HLA-binding.
Post-transplant T cells (7 yrs) from Pt 1 were stimulated weekly ex vivo for 4
weeks with 5 pools
of 6 mutated peptides with similar predicted EILA binding, per pool, and
subsequently tested by
IFN-y ELISPOT assay. FIG. 14B shows that increased IFN-7 secretion by T cells
was detected
19

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
against Pool 2 peptides. Negative control - Irrelevant Tax peptide; positive
control - PHA. FIG.
I4C shows that of Pool 2 peptides, Pt 1 T cells were reactive to mutated ALMS]
and C60RF89
peptides (right panel; averaged results from duplicate wells are displayed).
Left panel-The
predicted and experimental IC50 scores (nM) of mutated and wildtype ALMS] and
COORF89
peptides.
Figure 15 illustrates that the sequence context around the sites of mutations
in FNDC3B,
C6orf89 and ALMS] lack evolutionary conservation. The neoepitopes generated
from each of
the genes are boxed. Red- conserved amino acids (aa) in all 4 species; blue-
conserved aa in at
least 2 of 4 species; black --absent conservation across species.
Figure 16 shows localization of somatic mutations reported in FNDC3B, C6orf89
and
ALMS] genes. Missense mutations identified in FNDC3B, C6orf89 and ALMS] in CLL
Pts 1
and 2 compared to previously reported somatic mutations in these genes (COSMIC
database)
across cancers.
Figure 17 shows that mutated FNDC3B generates a naturally immunogenic
neoepitope in
Pt 2. FIG. 17A shows 26 missense mutations were identified in Pt 2 CLL cells
from which 37
peptides from 16 mutations were predicted to bind to Pt 2's MHC class I
alleles. A total of 18
peptides from 12 mutations were experimentally confirmed to bind. Post-
transplant T cells (-3
yrs) from Pt 2 were stimulated with autologous DCs or B cells pulsed with 3
pools of
experimentally validated binding mutated peptides (18 peptides total) for 2
weeks ex vivo (See
table S6). FIG. 17B shows increased IFN-y secretion was detected by ELISPOT
assay in T cells
stimulated with Pool 1 peptides. FIG. 17C shows that of Pool 1 peptides,
increased IFN-y
secretion was detected against the mut-FNDC3B peptide (bottom panel; averaged
results from
duplicated wells are displayed). Top panel - Predicted and experimental IC50
scores of mut- and
wt- FNDC3B peptides. FIG. 17D illustrates that T cells reactive to mut-FNDC3B
demonstrate
specificity to the mutated epitope but not the corresponding wildtype peptide
(concentrations:
0.1-10 pg/m1), and are polyfunctional, secreting IFN-y, GM-CSF and IL-2 (Tukey
post-hoc tests
from two-way ANOVA modeling for comparisons between T cell reactivity against
mut vs wt
peptide). FIG. 17E shows that Mut-FNDC3B-specific T cells are reactive in a
class I-restricted
manner (left), and recognize an endogenously processed and presented form of
mutated
FNDC313, since they recognized HLA-A2 APCs transfected with a plasmid encoding
a minigene
of 300bp encompassing the FNDC3B mutation (right) (two-sided t test). Top
right - Western blot

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
analysis-confirming expression of minigenes encoding mut- and wt- FNDC3B. FIG.
17F shows
that T cells recognizing the mut-FNDC3B epitope as detected by HLA-Anmut
FNDC3B
tetramers are more frequently detected in T cells in Pt 2 compared to T cells
from a normal
donor. FIG. 17G shows expression of FNDC3B (based on Affymetrix U133Plus2
array data) in
.. Pt 2 (triangle), CLL-B cells (n=182) and normal CD19+ B cells from healthy
adult volunteers
(n=24).
Figure 18 illustrates kinetics of the mut-FNDC3B specific T cell response in
relation to
the transplant course. FIG. 18 shows molecular tumor burden was measured in Pt
2 using a
patient tumor-specific Taqman PCR assay based on the clonotypic IgH sequence
at serial time
points before and after HSCT (top panel). Middle panel- Detection of mut-
FNDC3B reactive T
cells in comparison to wt-FNDC3B or irrelevant peptides from peripheral blood
before and after
allo-HSCT by IFN-y ELISPOT following stimulation with peptide-pulsed
autologous B cells.
The number of IFN-y-secreting spots per cells at each time point was measured
in triplicate
(Welch t test; mut vs. wt). Inset ¨ IFN-y secretion of T cells from 6 months
post-HSCT (purple)
.. compared to 32 months post-HSCT (red) following exposure to APCs pulsed
with 0.1-10 p,g/m1
(log scale) mut-FNDC3B peptide. Bottom panel - Detection of mut-FNDC3B-
specific TCR
VI311 cells by nested clone-specific CDR3 PCR before and after HSCT in
peripheral blood of Pt
2 (See supplementary methods). Triangles ¨ time points at which a sample was
tested; NA- no
amplification; black: amplification detected, where `+' indicates detectable
amplification up to 2-
fold and '++' indicates more than 2-fold greater amplification than the median
level of all
samples with detectable expression of the clone-specific VI311 sequence.
Figures I9A-D show the design of mut-FNDC3B specific TCR VP specific primers
in Pt
2. FIG. 19A shows mut-FNDC3B specific T cells detected and isolated from Pt 2
PBMCs 6
months following HSCT using an IFN- y catch assay. FIG. 19B shows RNA from
FNDC3B-
reactive T cells expressed TCR VI311, generating an amplicon of 350bp in
length. FIG. 19C
shows VI311-specific real time primers were designed based on the sequence of
the mut-
FNDC3B clone-specific CDR3 rearrangement, such that the quantitative PCR probe
was
positioned in the region of junctional diversity (orange). FIG. 19D shows
FNDC3B-reactive T
cells were monoclonal for V13 11, as detected by spectratyping.
Figures 20A-G illustrate the application of the neoantigen discovery pipeline
across
cancers. FIG. 20A shows the comparison of overall somatic mutation rate
detected across
21

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
cancers by massively parallel sequencing. Red-CLL; blue-clear cell renal
carcinoma (RCC) and
green- melanoma. LSCC: Lung squamous cell carcinoma, Lung AdCa: Lung
adenocarcinoma,
ESO AdCa: Esophageal adenocarcinoma, DLBCL: Diffused large B- cell lymphoma,
GBM:
Glioblastoma, Papillary RCC: Papillary renal cell carcinoma, Clear Cell RCC:
Clear cell renal
carcinoma, CIL: Chronic lymphoeytic leukemia, AML: Acute myeloid leukemia.
Distribution of
FIG. 20B shows the number of missense, frameshift and splice-site mutations
per case in
melanoma, clear cell RCC and CLL, FIG. 20C shows the average neo0RE length
generated per
sample and FIG, 20D shows predicted neopeptides with IC50 < 150 ri1V1 (dashed
lines) and < 500
nM (solid lines) generated from missense and frameshift mutations. FIGS. 20E
depicts the
distributions (shown by box plot) of the number of missense, frameshift and
splice-site mutations
per case across 13 cancers. FIG. 20F shows the summed neoORF length generated
per sample.
20G shows the predicted neopeptides with IC50 < 150 nM and with < 500 nM
generated from
missense and frameshift mutations,. For all box plots, the left and right ends
of the boxes
represent the 25th and 75th percentile values, respectively, while the segment
in the middle is the
median. The left and right extremes of the bars extend to the minimum and
maximum values..
DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to personalized strategies for the treatment of
neoplasia, and
more particularly tumors, by administering a therapeutically effective amount
of a
pharmaceutical composition (e.g., a cancer vaccine) comprising a plurality of
neoplasia/tumor
specific neo-antigens to a subject (e.g., a mammal such as a human). As
described in more detail
below, the present invention is based, at least in part, on the discovery that
whole genome/exome
sequencing may be used to identify all, or nearly all, mutated neo-antigens
that are uniquely
present in a neoplasia/tumor of an individual patient, and that this
collection of mutated neo-
antigens may be analyzed to identify a specific, optimized subset of neo-
antigens for use as a
personalized cancer vaccine for treatment of the patient's neoplasia/tumor.
For example, as
shown in FIG. 1, a population of neoplasia/tumor specific neo-antigens may be
identified by
sequencing the neoplasia/tumor and normal DNA of each patient to identify
tumor-specific
mutations, and determining the patient's HLA allotype. The population of
neoplasia/tumor
specific neo-antigens and their cognate native antigens may then be subject to
bioinformatic
analysis using validated algorithms to predict which tumor-specific mutations
create epitopes
22

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
that could bind to the patient's HLA allotype, and in particular which tumor-
specific mutations
create epitopes that could bind to the patient's HLA allotype more effectively
than the cognate
native antigen. Based on this analysis, a plurality of peptides corresponding
to a subset of these
mutations may be designed and synthesized for each patient, and pooled
together for use as a
cancer vaccine in immunizing the patient. The neo-antigens peptides may be
combined with an
adjuvant (e.g., poly-ICLC) or another anti-neoplastic agent. Without being
bound by theory,
these neo-antigens are expected to bypass central thymic tolerance (thus
allowing stronger anti-
tumor T cell response), while reducing the potential for autoimmunity (e.g.,
by avoiding
targeting of normal self-antigens).
The immune system can be classified into two functional subsystems: the innate
and the
acquired immune system. The innate immune system is the first line of defense
against
infections, and most potential pathogens are rapidly neutralized by this
system before they can
cause, for example, a noticeable infection. The acquired immune system reacts
to molecular
structures, referred to as antigens, of the intruding organism. There are two
types of acquired
immune reactions, which include the humoral immune reaction and the cell-
mediated immune
reaction. In the humoral immune reaction, antibodies secreted by B cells into
bodily fluids bind
to pathogen-derived antigens, leading to the elimination of the pathogen
through a variety of
mechanisms, e.g. complement-mediatedlysis. In the cell-mediated immune
reaction, T-cells
capable of destroying other cells are activated. For example, if proteins
associated with a disease
are present in a cell, they are fragmented proteolytically to peptides within
the cell. Specific cell
proteins then attach themselves to the antigen or peptide formed in this
manner and transport
them to the surface of the cell, where they are presented to the molecular
defense mechanisms, in
particular T-cells, of the body. Cytotoxic T cells recognize these antigens
and kill the cells that
harbor the antigens.
The molecules that transport and present peptides on the cell surface are
referred to as
proteins of the major histocompatibility complex (MHC). MHC proteins are
classified into two
types, referred to as MHC class I and MHC class II. The structures of the
proteins of the two
MHC classes are very similar; however, they have very different functions.
Proteins of MHC
class I are present on the surface of almost all cells of the body, including
most tumor cells.
MHC class I proteins are loaded with antigens that usually originate from
endogenous proteins or
from pathogens present inside cells, and are then presented to naive or
cytotoxic T-lymphocytes
23

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
(CTLs). MHC class II proteins are present on dendritic cells. B- lymphocytes,
macrophages and
other antigen-presenting cells. They mainly present peptides, which are
processed from external
antigen sources, i.e. outside of the cells, to T-helper (Th) cells. Most of
the peptides bound by
the MHC class I proteins originate from cytoplasmic proteins produced in the
healthy host cells
of an organism itself, and do not normally stimulate an immune reaction.
Accordingly, cytotoxic
T-lymphocytes that recognize such self-peptide-presenting MHC molecules of
class I are deleted
in the thymus (central tolerance) or, after their release from the thymus, are
deleted or
inactivated, i.e. tolerized (peripheral tolerance). MHC molecules are capable
of stimulating an
immune reaction when they present peptides to non-tolerized T-lymphocytes.
Cytotoxic T-
lymphocytes have both T-cell receptors (TCR) and CD8 molecules on their
surface. T-Cell
receptors are capable of recognizing and binding peptides complexed with the
molecules of
MHC class I. Each cytotoxic T-lymphocyte expresses a unique T-cell receptor
which is capable
of binding specific MHC/peptide complexes.
The peptide antigens attach themselves to the molecules of MHC class I by
competitive
affinity binding within the endoplasmic reticulum, before they are presented
on the cell surface.
Here, the affinity of an individual peptide antigen is directly linked to its
amino acid sequence
and the presence of specific binding motifs in defined positions within the
amino acid sequence.
If the sequence of such a peptide is known, it is possible to manipulate the
immune system
against diseased cells using, for example, peptide vaccines.
One of the critical barriers to developing curative and tumor-specific
immunotherapy is
the identification and selection of highly specific and restricted tumor
antigens to avoid
autoimmunity. Tumor neo-antigens, which arise as a result of genetic change
(e.g., inversions,
translocations, deletions, missense mutations, splice site mutations, etc.)
within malignant cells,
represent the most tumor-specific class of antigens. Neo-antigens have rarely
been used in
cancer vaccines due to technical difficulties in identifying them, selecting
optimized neo-
antigens, and producing neo-antigens for use in a vaccine. According to the
present invention,
these problems may be addressed by:
= identifying all, or nearly all, mutations in the neoplasia/tumor at the
DNA level using
whole genome, whole exome (e.g., only captured exons), or RNA sequencing of
tumor versus
matched germline samples from each patient;
24

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
= analyzing the identified mutations with one or more peptide-MHC binding
prediction
algorithms to generate a plurality of candidate neo-antigen T cell epitopes
that are expressed
within the neoplasia/tumor and may bind patient HLA alleles; and
= synthesizing the plurality of candidate neo-antigen peptides selected
from the sets of all
neo0RF peptides and predicted binding peptides for use in a cancer vaccine.
For example, translating sequencing information into a therapeutic vaccine may
include:
(1) Prediction of personal mutated peptides that can bind to HLA molecules of
the
individual. Efficiently choosing which particular mutations to utilize as
immunogen requires
identification of the patient HLA type and the ability to predict which
mutated peptides would
efficiently bind to the patient's HLA alleles. Recently, neural network based
learning approaches
with validated binding and non-binding peptides have advanced the accuracy of
prediction
algorithms for the major HLA-A and -B alleles.
(2) Formulating the drug as a multi -epitope vaccine of long peptides.
Targeting as many
mutated epitopes as practically possible takes advantage of the enormous
capacity of the immune
system, prevents the opportunity for immunological escape by down-modulation
of a particular
immune targeted gene product, and compensates for the known inaccuracy of
epitope prediction
approaches. Synthetic peptides provide a particularly useful means to prepare
multiple
immunogens efficiently and to rapidly translate identification of mutant
epitopes to an effective
vaccine. Peptides can be readily synthesized chemically and easily purified
utilizing reagents
free of contaminating bacteria or animal substances. The small size allows a
clear focus on the
mutated region of the protein and also reduces irrelevant antigenic
competition from other
components (unmutated protein or viral vector antigens).
(3) Combination with a strong vaccine adjuvant. Effective vaccines require a
strong
adjuvant to initiate an immune response. As described below, poly-ICLC, an
agonist of TLR3
and the RNA helicase ¨domains of MDA5 and RIG3, has shown several desirable
properties for
a vaccine adjuvant. These properties include the induction of local and
systemic activation of
immune cells in vivo, production of stimulatory chemokines and cytokines, and
stimulation of
antigen-presentation by DCs. Furthermore, poly-ICLC can induce durable CD4+
and CD8+
responses in humans. Importantly, striking similarities in the upregulation of
transcriptional and
signal transduction pathways were seen in subjects vaccinated with poly-ICLC
and in volunteers
who had received the highly effective, replication-competent yellow fever
vaccine. Furthermore.

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
>90% of ovarian carcinoma patients immunized with poly-ICLC in combination
with a NY-
ESO-1 peptide vaccine (in addition to Montanide) showed induction of CD4+ and
CD8+ T cell,
as well as antibody responses to the peptide in a recent phase 1 study. At the
same time, poly-
ICLC has been extensively tested in more than 25 clinical trials to date and
exhibited a relatively
benign toxicity profile.
The above-described advantages of the invention are described in further
detail below.
Identification of Tumor Specific Neo-antigen Mutations
The present invention is based, at least in part, on the ability to identify
all, or nearly all,
of the mutations within a neoplasia/tumor (e.g., translocations, inversions,
large and small
deletions and insertions, missense mutations, splice site mutations, etc.). In
particular, these
mutations are present in the genome of neoplasia/tumor cells of a subject, but
not in normal
tissue from the subject. Such mutations are of particular interest if they
lead to changes that
result in a protein with an altered amino acid sequence that is unique to the
patient's
neoplasia/tumor (e.g., a neo-antigen). For example, useful mutations may
include: (1) non-
synonymous mutations leading to different amino acids in the protein; (2) read-
through
mutations in which a stop codon is modified or deleted, leading to translation
of a longer protein
with a novel tumor-specific sequence at the C-terminus; (3) splice site
mutations that lead to the
inclusion of an intron in the mature mRNA and thus a unique tumor-specific
protein sequence;
(4) chromosomal rearrangements that give rise to a chimeric protein with tumor-
specific
sequences at the junction of 2 proteins (i.e., gene fusion); (5) frameshift
mutations or deletions
that lead to a new open reading frame with a novel tumor-specific protein
sequence; and the like.
Peptides with mutations or mutated polypeptides arising from, for example,
splice- site,
frameshift, read-through, or gene fusion mutations in tumor cells may be
identified by
sequencing DNA, RNA or protein in tumor versus normal cells.
Also within the scope of the inventions is personal neo-antigen peptides
derived from
common tumor driver genes and may further include previously identified tumor
specific
mutations. For example, known common tumor driver genes and tumor mutations in
common
tumor driver genes may be found on the world wide web at
(www)sanger.ac.uk/cosmic.
A number of initiatives are currently underway to obtain sequence information
directly
from millions of individual molecules of DNA or RNA in parallel. Real-time
single molecule
26

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
sequencing-by-synthesis technologies rely on the detection of fluorescent
nucleotides as they are
incorporated into a nascent strand of DNA that is complementary to the
template being
sequenced. In one method, oligonucleotides 30-50 bases in length are
covalently anchored at the
5' end to glass cover slips. These anchored strands perform two functions.
First, they act as
capture sites for the target template strands if the templates are configured
with capture tails
complementary to the surface-bound oligonucleotides. They also act as primers
for the template
directed primer extension that forms the basis of the sequence reading. The
capture primers
function as a fixed position site for sequence determination using multiple
cycles of synthesis,
detection, and chemical cleavage of the dye-linker to remove the dye. Each
cycle consists of
adding the polymerase/labeled nucleotide mixture, rinsing, imaging and
cleavage of dye. In an
alternative method, polymerase is modified with a fluorescent donor molecule
and immobilized
on a glass slide, while each nucleotide is color-coded with an acceptor
fluorescent moiety
attached to a gamma-phosphate. The system detects the interaction between a
fluorescently-
tagged polymerase and a fluorescently modified nucleotide as the nucleotide
becomes
incorporated into the de novo chain. Other sequencing-by-synthesis
technologies also exist.
Preferably, any suitable sequencing-by-synthesis platform can be used to
identify
mutations. Four major sequencing-by-synthesis platforms are currently
available: the Genome
Sequencers from Roche/454 Life Sciences, the HiSeq Analyzer from
Illumina/Solexa, the
SOLiD system from Applied BioSystems, and the Heliscope system from Helicos
Biosciences.
Sequencing-by-synthesis platforms have also been described by Pacific
Biosciences and VisiGen
Biotechnologies. Each of these platforms can be used in the methods of the
invention. In some
embodiments, a plurality of nucleic acid molecules being sequenced is bound to
a support (e.g.,
solid support). To immobilize the nucleic acid on a support, a capture
sequence/universal
priming site can be added at the 3' and/or 5' end of the template. The nucleic
acids may be bound
to the support by hybridizing the capture sequence to a complementary sequence
covalently
attached to the support. The capture sequence (also referred to as a universal
capture sequence)
is a nucleic acid sequence complementary to a sequence attached to a support
that may dually
serve as a universal primer.
As an alternative to a capture sequence, a member of a coupling pair (such as,
e.g.,
antibody/antigen, receptor/ligand, or the avidin-biotin pair as described in,
e.g., U.S. Patent
Application No. 2006/0252077) may be linked to each fragment to be captured on
a surface
27

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
coated with a respective second member of that coupling pair. Subsequent to
the capture, the
sequence may be analyzed, for example, by single molecule
detection/sequencing, e.g., as
described in the Examples and in U.S. Patent No. 7,283,337, including template-
dependent
sequencing-by- synthesis. In sequencing-by-synthesis, the surface-bound
molecule is exposed to
a plurality of labeled nucleotide triphosphates in the presence of polymerase.
The sequence of
the template is determined by the order of labeled nucleotides incorporated
into the 3 end of the
growing chain. This can be done in real time or in a step-and-repeat mode. For
real-time
analysis, different optical labels to each nucleotide may be incorporated and
multiple lasers may
be utilized for stimulation of incorporated nucleotides.
Any cell type or tissue may be utilized to obtain nucleic acid samples for use
in the
sequencing methods described herein. In a preferred embodiment, the DNA or RNA
sample is
obtained from a neoplasia/tumor or a bodily fluid, e.g., blood, obtained by
known techniques
(e.g. venipuncture) or saliva. Alternatively, nucleic acid tests can be
performed on dry samples
(e.g. hair or skin).
A variety of methods are available for detecting the presence of a particular
mutation or
allele in an individual's DNA or RNA. Advancements in this field have provided
accurate, easy,
and inexpensive large-scale SNP genotyping. Most recently, for example,
several new
techniques have been described including dynamic allele-specific hybridization
(DASH),
microplate array diagonal gel electrophoresis (MADGE), pyrosequencing,
oligonucleotide-
specific ligation, the TaqMan system as well as various DNA "chip"
technologies such as the
Affymetrix SNP chips. These methods require amplification of the target
genetic region,
typically by PCR. Still other newly developed methods, based on the generation
of small signal
molecules by invasive cleavage followed by mass spectrometry or immobilized
padlock probes
and rolling-circle amplification, might eventually eliminate the need for PCR.
Several of the
methods known in the art for detecting specific single nucleotide
polymorphisms are summarized
below. The method of the present invention is understood to include all
available methods.
PCR based detection means may include multiplex amplification of a plurality
of markers
simultaneously. For example, it is well known in the art to select PCR primers
to generate PCR
products that do not overlap in size and can be analyzed simultaneously.
Alternatively, it is possible to amplify different markers with primers that
are
differentially labeled and thus can each be differentially detected. Of
course, hybridization based
28

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
detection means allow the differential detection of multiple PCR products in a
sample. Other
techniques are known in the art to allow multiplex analyses of a plurality of
markers.
Several methods have been developed to facilitate analysis of single
nucleotide
polymorphisms in genomic DNA or cellular RNA. In one embodiment, the single
base
polymorphism can be detected by using a specialized exonuclease-resistant
nucleotide, as
disclosed, e.g., U.S. Patent No. 4,656,127. According to the method, a primer
complementary to
the allelic sequence immediately 3' to the polymorphic site is permitted to
hybridize to a target
molecule obtained from a particular animal or human. If the polymorphic site
on the target
molecule contains a nucleotide that is complementary to the particular
exonuclease-resistant
nucleotide derivative present, then that derivative will be incorporated onto
the end of the
hybridized primer. Such incorporation renders the primer resistant to
exonuclease, and thereby
permits its detection. Since the identity of the exonuclease-resistant
derivative of the sample is
known, a finding that the primer has become resistant to exonucleases reveals
that the nucleotide
present in the polymorphic site of the target molecule was complementary to
that of the
nucleotide derivative used in the reaction. This method has the advantage that
it does not require
the determination of large amounts of extraneous sequence data.
In another embodiment of the invention, a solution-based method is used for
determining
the identity of the nucleotide of a polymorphic site. Cohen et al. (French
Patent No. 2,650,840;
PCT Application No. W01991/02087). As in the method of U.S. Patent No.
4,656,127. a
primer may be employed that is complementary to allelic sequences immediately
3' to a
polymorphic site. The method determines the identity of the nucleotide of that
site using labeled
dideoxynucleotide derivatives, which, if complementary to the nucleotide of
the polymorphic
site, will become incorporated onto the terminus of the primer.
An alternative method, known as Genetic Bit Analysis or GBA is described in
PCT
Application No. W01992/15712). GBA uses mixtures of labeled terminators and a
primer
that is complementary to the sequence 3' to a polymorphic site. The labeled
terminator that is
incorporated is thus determined by, and complementary to, the nucleotide
present in the
polymorphic site of the target molecule being evaluated. In contrast to the
method of Cohen et
al. (French Patent 2,650,840; PCT Application No. W01991/02087) the GBA
method is
.. preferably a heterogeneous phase assay, in which the primer or the target
molecule is
immobilized to a solid phase.
29

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Recently, several primer-guided nucleotide incorporation procedures for
assaying
polymorphic sites in DNA have been described (Komher, J. S. et al., Nucl.
Acids. Res.
17:7779- 7784 (1989); Sokolov, B. P., Nucl. Acids Res. 18:3671 (1990);
Syvanen, A.-C, et al.,
Genomics 8:684-692 (1990); Kuppuswamy, M. N. et al., Proc. Natl. Acad. Sci.
(U.S.A.) 88:
1143- 1147 (1991); Prezant, T. R. et al., Hum. Mutat. 1: 159-164 (1992);
Ugozzoli, L. et al.,
GATA 9: 107- 112 (1992); Nyren, P. et al., Anal. Biochem. 208: 171-175
(1993)). These
methods differ from GBA in that they all rely on the incorporation of labeled
deoxynucleotides
to discriminate between bases at a polymorphic site. In such a format, since
the signal is
proportional to the number of deoxynucleotides incorporated, polymorphisms
that occur in runs
of the same nucleotide can result in signals that are proportional to the
length of the run
(Syvanen, A.-C, et al., Amer. J. Hum. Genet. 52:46-59 (1993)).
An alternative method for identifying tumor specific neo-antigens is direct
protein
sequencing. Protein sequencing of enzymatic digests using multidimensional MS
techniques
(MSn) including tandem mass spectrometry (MS/MS)) can also be used to identify
neo-antigens
of the invention. Such proteomic approaches permit rapid, highly automated
analysis (see, e.g.,
K. Gevaert and J. V andekerckhove, Electrophoresis 21:1145-1154 (2000)). It is
further
contemplated within the scope of the invention that high-throughput methods
for de novo
sequencing of unknown proteins may be used to analyze the proteome of a
patient's tumor to
identify expressed neo-antigens. For example, meta shotgun protein sequencing
may be used to
identify expressed neo-antigens (see e.g., Guthals et al. (2012) Shotgun
Protein Sequencing with
Meta-contig Assembly, Molecular and Cellular Proteomics 11(10):1084-96).
Tumor specific neo-antigens may also be identified using MHC multimers to
identify
neo-antigen-specific T-cell responses. For example, highthroughput analysis of
neo-antigen-
specific T-cell responses in patient samples may be performed using MHC
tetramer-based
screening techniques (see e.g., Hombrink et al. (2011) High-Throughput
Identification of
Potential Minor Histocompatibility Antigens by MHC Tetramer-Based Screening:
Feasibility
and Limitations 6(8):1-11; Hadrup et al. (2009) Parallel detection of antigen-
specific T-cell
responses by multidimensional encoding of MHC multimers, Nature Methods,
6(7):520-26; van
Rooij et al. (2013) Tumor exome analysis reveals neoantigen-specific T-cell
reactivity in an
Ipilimumab-responsive melanoma, Journal of Clinical Oncology, 31:1-4; and
Heemskerk et al.
(2013) The cancer antigenome, EMBO Journal, 32(2):194-203). It is contemplated
within the

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
scope of the invention that such tetramer-based screening techniques may be
used for the initial
identification of tumor specific neo-antigens, or alternatively as a secondary
screening protocol
to assess what neo-antigens a patient may have already been exposed to,
thereby facilitating the
selection of candidate neo-antigens for the vaccines of the invention.
Design of Tumor Specific Neo-Antigens
The invention further includes isolated peptides (e.g., neo-antigenic peptides
containing
the tumor specific mutations identified by the methods of the invention,
peptides that comprise
know tumor specific mutations, and mutant polypeptides or fragments thereof
identified by the
method of the invention). These peptides and polypeptides are referred to
herein as "neo-
antigenic peptides" or "neo-antigenic polypeptides." The term "peptide" is
used interchangeably
with "mutant peptide" and "neo-antigenic peptide" and "wildtype peptide" in
the present
specification to designate a series of residues, typically L-amino acids,
connected one to the
other, typically by peptide bonds between the alpha-amino and alpha-carboxyl
groups of
adjacent amino acids. The polypeptides or peptides can be of a variety of
lengths and will
minimally include the small region predicted to bind to the HLA molecule of
the patient (the
"epitope") as well as additional adjacent amino acids extending in both the N-
and C-terminal
directions. The polypeptides or peptides can be either in their neutral
(uncharged) forms or in
forms which are salts, and either free of modifications such as glycosylation,
side chain
oxidation, or phosphorylation or containing these modifications, subject to
the condition that the
modification not destroy the biological activity of the polypeptides as herein
described.
In certain embodiments the size of the at least one neo-antigenic peptide
molecule may
comprise, but is not limited to. about 8, about 9, about 10, about 11, about
12, about 13, about
14, about 15, about 16, about 17, about 18, about 19, about 20, about 21,
about 22, about 23,
about 24, about 25, about 26, about 27, about 28, about 29, about 30, about
31, about 32. about
33, about 34, about 35, about 36, about 37, about 38, about 39, about 40,
about 41, about 42,
about 43, about 44, about 45, about 46, about 47, about 48, about 49, about
50, about 60. about
70, about 80, about 90, about 100, about 110, about 120 or greater amino
molecule residues, and
any range derivable therein. In specific embodiments the neo-antigenic peptide
molecules are
equal to or less than 50 amino acids. In a preferred embodiment, the neo-
antigenic peptide
molecules are equal to about 20 to about 30 amino acids.
31

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
A longer peptide may be designed in several ways. For example, when the HLA-
binding
regions (e.g., the "epitopes") are predicted or known, a longer peptide may
consist of either:
individual binding peptides with an extension of 0-10 amino acids toward the N-
and C-terminus
of each corresponding gene product. A longer peptide may also consist of a
concatenation of
some or all of the binding peptides with extended sequences for each. In
another case, when
sequencing reveals a long (>10 residues) neo-epitope sequence present in the
tumor (e.g. due to
a frameshift, read-through or intron inclusion that leads to a novel peptide
sequence), a longer
peptide may consist of the entire stretch of novel tumor-specific amino acids.
In both cases, use
of a longer peptide requires endogenous processing by professional antigen
presenting cells such
as dendritic cells and may lead to more effective antigen presentation and
induction of T cell
responses. In some cases, it is desirable or preferable to alter the extended
sequence to improve
the biochemical properties of the polypeptide (properties such as solubility
or stability) or to
improve the likelihood for efficient proteasomal processing of the peptide
(Zhang et al (2012)
Aminopeptidase substrate preference affects HIV epitope presentation and
predicts immune
escape patterns in HIV-infected individuals. J. Immunol 188:5924-34; Hearn et
al (2010)
Characterizing the specificity and co-operation of aminopeptidases in the
cytosol and ER during
MHC Class I antigen presentation. J. Immunol 184(9):4725-32; Wiemerhaus et al
(2012)
Peptidases trimming MHC Class I ligands. Curr Opin Immunol 25:1-7).
The neo-antigenic peptides and polypeptides may bind an HLA protein. In
preferred
aspects, the neo-antigenic peptides and polypeptides may bind an HLA protein
with greater
affinity than the corresponding native / wild-type peptide. The neo-antigenic
peptide or
polypeptide may have an IC50 of about less than 1000 nM, about less than 500
nM, about less
than 250 nM, about less than 200 nM, about less than 150 nM, about less than
100 nM, or about
less than 50 nM.
In a preferred embodiment, the neo-antigenic peptides and polypeptides of the
invention
do not induce an autoimmune response and/or invoke immunological tolerance
when
administered to a subject.
The invention also provides compositions comprising a plurality of neo-
antigenic
peptides. In some embodiments, the composition comprises at least 5 or more
neo-antigenic
peptides. In some embodiments the composition contains at least about 6. about
8, about 10,
about 12, about 14, about 16, about 18, or about 20 distinct peptides. In some
embodiments the
32

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
composition contains at least 20 distinct peptides. According to the
invention, 2 or more of the
distinct peptides may be derived from the same polypeptide. For example, if a
preferred neo-
antigenic mutation encodes a neo0RF polypeptide, two or more of the neo-
antigenic peptides
may be derived from the neo0RF polypeptide. In one embodiment, the two or more
neo-
.. antigenic peptides derived from the neo0RF polypeptide may comprise a tiled
array that spans
the polypeptide (e.g., the neo-antigenic peptides may comprise a series of
overlapping neo-
antigenic peptides that spans a portion, or all, of the neo0RF polypeptide).
Without being bound
by theory, each peptide is believed to have its own epitope; accordingly, a
tiling array that spans
one neo0RF polypeptide may give rise to polypeptides that are targeted to
different HLA
molecules. Neo-antigenic peptides can be derived from any protein coding gene.
Exemplary
polypeptides from which the neo-antigenic peptides may be derived can be found
for example at
the COSMIC database (on the worldwide web at (www)sanger.ac.uk/cosmic). COSMIC
curates
comprehensive information on somatic mutations in human cancer. The peptide
may contain the
tumor specific mutation. In some aspects the tumor specific mutation is in a
common driver
.. gene or is a common driver mutation for a particular cancer type. For
example, common driver
mutation peptides may include, but are not limited to, the following: a SF3B1
polypeptide, a
MYD88 polypeptide, a TP53 polypeptide, an ATM polypeptide, an Abl polypeptide,
A FBXW7
polypeptide, a DDX3X polypeptide, a MAPK1 polypeptide, or a GNB1 polypeptide.
The neo-antigenic peptides, polypeptides, and analogs can be further modified
to contain
.. additional chemical moieties not normally part of the protein. Those
derivatized moieties can
improve the solubility, the biological half-life, absorption of the protein,
or binding affinity. The
moieties can also reduce or eliminate any desirable side effects of the
proteins and the like. An
overview for those moieties can be found in Remington's Pharmaceutical
Sciences, 20th ed..
Mack Publishing Co., Easton, PA (2000).
For example, neo-antigenic peptides and polypeptides having the desired
activity may be
modified as necessary to provide certain desired attributes, e.g. improved
pharmacological
characteristics, while increasing or at least retaining substantially all of
the biological activity of
the unmodified peptide to bind the desired MHC molecule and activate the
appropriate T cell.
For instance, the neo-antigenic peptide and polypeptides may be subject to
various changes, such
.. as substitutions, either conservative or non-conservative, where such
changes might provide for
certain advantages in their use, such as improved MHC binding. Such
conservative substitutions
33

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
may encompass replacing an amino acid residue with another amino acid residue
that is
biologically and/or chemically similar, e.g., one hydrophobic residue for
another, or one polar
residue for another. The effect of single amino acid substitutions may also be
probed using D-
amino acids. Such modifications may be made using well known peptide synthesis
procedures,
as described in e.g., Merrifield, Science 232:341-347 (1986), Barany &
Merrifield, The Peptides,
Gross & Meienhofer, eds. (N.Y., Academic Press), pp. 1-284 (1979); and Stewart
& Young,
Solid Phase Peptide Synthesis, (Rockford, III., Pierce), 2d Ed. (1984).
The neo-antigenic peptide and polypeptides may also be modified by extending
or
decreasing the compound's amino acid sequence, e.g., by the addition or
deletion of amino acids.
The neo-antigenic peptides, polypeptides, or analogs can also be modified by
altering the order
or composition of certain residues. It will be appreciated by the skilled
artisan that certain amino
acid residues essential for biological activity, e.g., those at critical
contact sites or conserved
residues, may generally not be altered without an adverse effect on biological
activity. The non-
critical amino acids need not be limited to those naturally occurring in
proteins, such as L-a-
amino acids, or their D-isomers, but may include non-natural amino acids as
well, such as
amino acids, as well as many derivatives of L-a-amino acids.
Typically, a neo-antigen polypeptide or peptide may be optimized by using a
series of
peptides with single amino acid substitutions to determine the effect of
electrostatic charge,
hydrophobicity, etc. on MHC binding. For instance, a series of positively
charged (e.g., Lys or
Arg) or negatively charged (e.g., Glu) amino acid substitutions may be made
along the length of
the peptide revealing different patterns of sensitivity towards various MHC
molecules and T cell
receptors. In addition, multiple substitutions using small, relatively neutral
moieties such as Ala,
Gly, Pro, or similar residues may be employed. The substitutions may be homo-
oligomers or
hetero-oligomers. The number and types of residues which are substituted or
added depend on
the spacing necessary between essential contact points and certain functional
attributes which are
sought (e.g., hydrophobicity versus hydrophilicity). Increased binding
affinity for an MHC
molecule or T cell receptor may also be achieved by such substitutions,
compared to the affinity
of the parent peptide. In any event, such substitutions should employ amino
acid residues or
other molecular fragments chosen to avoid, for example, steric and charge
interference which
might disrupt binding.
34

CA 02908434 2015-09-30
WO 2014/168874 PCT/1JS2014/033185
Amino acid substitutions are typically of single residues. Substitutions,
deletions,
insertions or any combination thereof may be combined to arrive at a final
peptide.
Substitutional variants are those in which at least one residue of a peptide
has been removed and
a different residue inserted in its place.
The neo-antigenic peptides and polypeptides may be modified to provide desired
attributes. For instance, the ability of the peptides to induce CTL activity
can be enhanced by
linkage to a sequence which contains at least one epitope that is capable of
inducing a T helper
cell response. Particularly preferred immunogenic peptides/T helper conjugates
are linked by a
spacer molecule. The spacer is typically comprised of relatively small,
neutral molecules, such
as amino acids or amino acid mimetics, which are substantially uncharged under
physiological
conditions. The spacers are typically selected from, e.g., Ala, Gly, or other
neutral spacers of
nonpolar amino acids or neutral polar amino acids. It will be understood that
the optionally
present spacer need not be comprised of the same residues and thus may be a
hetero- or homo-
oligomer. When present, the spacer will usually be at least one or two
residues, more usually
three to six residues. Alternatively, the peptide may be linked to the T
helper peptide without a
spacer.
The neo-antigenic peptide may be linked to the T helper peptide either
directly or via a
spacer either at the amino or carboxy terminus of the peptide. The amino
terminus of either the
neo-antigenic peptide or the T helper peptide may be acylated. Exemplary T
helper peptides
include tetanus toxoid 830-843, influenza 307-319, malaria circumsporozoite
382-398 and 378-
389.
Production of Tumor Specific Neo-antigens
The present invention is based, at least in part, on the ability to present
the immune
system of the patient with a pool of tumor specific neo-antigens. One of skill
in the art will
appreciate that there are a variety of ways in which to produce such tumor
specific neo-antigens.
In general, such tumor specific neo-antigens may be produced either in vitro
or in vivo. Tumor
specific neo-antigens may be produced in vitro as peptides or polypeptides,
which may then be
formulated into a personalized neoplasia vaccine and administered to a
subject. As described in
further detail below, such in vitro production may occur by a variety of
methods known to one of
skill in the art such as, for example, peptide synthesis or expression of a
peptide/polypeptide

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
from a DNA or RNA molecule in any of a variety of bacterial, eukaryotic, or
viral recombinant
expression systems, followed by purification of the expressed
peptide/polypeptide.
Alternatively, tumor specific neo-antigens may be produced in vivo by
introducing molecules
(e.g., DNA, RNA, viral expression systems, and the like) that encode tumor
specific neo-
antigens into a subject, whereupon the encoded tumor specific neo-antigens are
expressed.
In Vitro Peptide/Polypeptide Synthesis
Proteins or peptides may be made by any technique known to those of skill in
the art,
including the expression of proteins, polypeptides or peptides through
standard molecular
biological techniques, the isolation of proteins or peptides from natural
sources, or the chemical
synthesis of proteins or peptides. The nucleotide and protein, polypeptide and
peptide sequences
corresponding to various genes have been previously disclosed, and may be
found at
computerized databases known to those of ordinary skill in the art. One such
database is the
National Center for Biotechnology Information's Genbank and GenPept databases
located at the
National Institutes of Health website. The coding regions for known genes may
be amplified
and/or expressed using the techniques disclosed herein or as would be known to
those of
ordinary skill in the art. Alternatively, various commercial preparations of
proteins, polypeptides
and peptides are known to those of skill in the art.
Peptides can be readily synthesized chemically utilizing reagents that are
free of
contaminating bacterial or animal substances (Merrifield RB: Solid phase
peptide synthesis. I.
The synthesis of a tetrapeptide. J. Am. Chem. Soc. 85:2149-54, 1963).
A further aspect of the invention provides a nucleic acid (e.g., a
polynucleotide) encoding
a neo-antigenic peptide of the invention, which may be used to produce the neo-
antigenic peptide
in vitro. The polynucleotide may be, e.g., DNA, cDNA, PNA, CNA. RNA, either
single- and/or
double-stranded, or native or stabilized forms of polynucleotides, such as
e.g. polynucleotides
with a phosphorothiate backbone, or combinations thereof and it may or may not
contain introns
so long as it codes for the peptide. A still further aspect of the invention
provides an expression
vector capable of expressing a polypeptide according to the invention.
Expression vectors for
different cell types are well known in the art and can be selected without
undue experimentation.
Generally, the DNA is inserted into an expression vector, such as a plasmid,
in proper orientation
and correct reading frame for expression. If necessary, the DNA may be linked
to the
36

CA 02908434 2015-09-30
WO 2014/168874 PCT/1JS2014/033185
appropriate transcriptional and translational regulatory control nucleotide
sequences recognized
by the desired host (e.g., bacteria), although such controls are generally
available in the
expression vector. The vector is then introduced into the host bacteria for
cloning using standard
techniques (see, e.g., Sambrook et al. (1989) Molecular Cloning, A Laboratory
Manual, Cold
__ Spring Harbor Laboratory, Cold Spring Harbor, N.Y.).
The invention further embraces variants and equivalents which are
substantially
homologous to the identified tumor specific neo-antigens described herein.
These can contain,
for example, conservative substitution mutations, i.e., the substitution of
one or more amino
acids by similar amino acids. For example, conservative substitution refers to
the substitution of
an amino acid with another within the same general class such as, for example,
one acidic amino
acid with another acidic amino acid, one basic amino acid with another basic
amino acid, or one
neutral amino acid by another neutral amino acid. What is intended by a
conservative amino
acid substitution is well known in the art.
The invention also includes expression vectors comprising the isolated
polynucleotides,
as well as host cells containing the expression vectors. It is also
contemplated within the scope
of the invention that the neo-antigenic peptides may be provided in the form
of RNA or cDNA
molecules encoding the desired neo-antigenic peptides. The invention also
provides that the one
or more neo-antigenic peptides of the invention may be encoded by a single
expression vector.
The invention also provides that the one or more neo-antigenic peptides of the
invention may be
encoded and expressed in vivo using a viral based system (e.g., an adenovirus
system).
The term "polynucleotide encoding a polypeptide" encompasses a polynucleotide
which
includes only coding sequences for the polypeptide as well as a polynucleotide
which includes
additional coding and/or non-coding sequences. The polynucleotides of the
invention can be in
the form of RNA or in the form of DNA. DNA includes cDNA, genomic DNA, and
synthetic
DNA; and can be double-stranded or single-stranded, and if single stranded can
be the coding
strand or non-coding (anti-sense) strand.
In embodiments, the polynucleotides may comprise the coding sequence for the
tumor
specific neo-antigenic peptide fused in the same reading frame to a
polynucleotide which aids,
for example, in expression and/or secretion of a polypeptide from a host cell
(e.g., a leader
sequence which functions as a secretory sequence for controlling transport of
a polypeptide from
37

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
the cell). The polypeptide having a leader sequence is a preprotein and can
have the leader
sequence cleaved by the host cell to form the mature form of the polypeptide.
In embodiments, the polynucleotides can comprise the coding sequence for the
tumor
specific neo-antigenic peptide fused in the same reading frame to a marker
sequence that allows,
for example, for purification of the encoded polypeptide, which may then be
incorporated into
the personalized neoplasia vaccine. For example, the marker sequence can be a
hexa-histidine
tag supplied by a pQE-9 vector to provide for purification of the mature
polypeptide fused to the
marker in the case of a bacterial host, or the marker sequence can be a
hemagglutinin (HA) tag
derived from the influenza hemagglutinin protein when a mammalian host (e.g.,
COS-7 cells) is
used. Additional tags include, but are not limited to, Calmodulin tags, FLAG
tags. Myc tags, S
tags, SBP tags, Softag 1. Softag 3, V5 tag, Xpress tag, Isopeptag, SpyTag,
Biotin Carboxyl
Carrier Protein (BCCP) tags. GST tags, fluorescent protein tags (e.g., green
fluorescent protein
tags), maltose binding protein tags, Nus tags, Strep-tag, thioredoxin tag, TC
tag, Ty tag, and the
like.
In embodiments, the polynucleotides may comprise the coding sequence for one
or more
of the tumor specific neo-antigenic peptides fused in the same reading frame
to create a single
concatamerized neo-antigenic peptide construct capable of producing multiple
neo-antigenic
peptides.
In embodiments, the present invention provides isolated nucleic acid molecules
having a
nucleotide sequence at least 60% identical, at least 65% identical, at least
70% identical, at least
75% identical, at least 80% identical, at least 85% identical, at least 90%
identical, at least 95%
identical, or at least 96%, 97%, 98% or 99% identical to a polynucleotide
encoding a tumor
specific neo-antigenic peptide of the present invention.
By a polynucleotide having a nucleotide sequence at least, for example, 95%
"identical"
to a reference nucleotide sequence is intended that the nucleotide sequence of
the polynucleotide
is identical to the reference sequence except that the polynucleotide sequence
can include up to
five point mutations per each 100 nucleotides of the reference nucleotide
sequence. In other
words, to obtain a polynucleotide having a nucleotide sequence at least 95%
identical to a
reference nucleotide sequence, up to 5% of the nucleotides in the reference
sequence can be
deleted or substituted with another nucleotide, or a number of nucleotides up
to 5% of the total
38

CA 02908434 2015-09-30
WO 2014/168874 PCT/1JS2014/033185
nucleotides in the reference sequence can be inserted into the reference
sequence. These
mutations of the reference sequence can occur at the amino- or carboxy-
terminal positions of the
reference nucleotide sequence or anywhere between those terminal positions,
interspersed either
individually among nucleotides in the reference sequence or in one or more
contiguous groups
within the reference sequence.
As a practical matter, whether any particular nucleic acid molecule is at
least 80%
identical, at least 85% identical, at least 90% identical, and in some
embodiments, at least 95%,
96%, 97%, 98%, or 99% identical to a reference sequence can be determined
conventionally
using known computer programs such as the Bestfit program (Wisconsin Sequence
Analysis
Package, Version 8 for Unix, Genetics Computer Group, University Research
Park, 575 Science
Drive, Madison, WI 53711). Bestfit uses the local homology algorithm of Smith
and Waterman,
Advances in Applied Mathematics 2:482-489 (1981), to find the best segment of
homology
between two sequences. When using Bestfit or any other sequence alignment
program to
determine whether a particular sequence is, for instance. 95% identical to a
reference sequence
according to the present invention, the parameters are set such that the
percentage of identity is
calculated over the full length of the reference nucleotide sequence and that
gaps in homology of
up to 5% of the total number of nucleotides in the reference sequence are
allowed.
The isolated tumor specific neo-antigenic peptides described herein can be
produced in
vitro (e.g., in the laboratory) by any suitable method known in the art. Such
methods range from
direct protein synthetic methods to constructing a DNA sequence encoding
isolated polypeptide
sequences and expressing those sequences in a suitable transformed host. In
some embodiments,
a DNA sequence is constructed using recombinant technology by isolating or
synthesizing a
DNA sequence encoding a wild-type protein of interest. Optionally, the
sequence can be
mutagenized by site-specific mutagenesis to provide functional analogs
thereof. See, e.g. Zoeller
et al., Proc. Nat'l. Acad. Sci. USA 81:5662-5066 (1984) and U.S. Pat. No.
4.588,585.
In embodiments, a DNA sequence encoding a polypeptide of interest would be
constructed by chemical synthesis using an oligonucleotide synthesizer. Such
oligonucleotides
can be designed based on the amino acid sequence of the desired polypeptide
and selecting those
codons that are favored in the host cell in which the recombinant polypeptide
of interest will be
produced. Standard methods can be applied to synthesize an isolated
polynucleotide sequence
39

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
encoding an isolated polypeptide of interest. For example, a complete amino
acid sequence can
be used to construct a back-translated gene. Further, a DNA oligomer
containing a nucleotide
sequence coding for the particular isolated polypeptide can be synthesized.
For example, several
small oligonucleotides coding for portions of the desired polypeptide can be
synthesized and
then ligated. The individual oligonucleotides typically contain 5' or 3'
overhangs for
complementary assembly.
Once assembled (e.g., by synthesis, site-directed mutagenesis, or another
method), the
polynucleotide sequences encoding a particular isolated polypeptide of
interest will be inserted
into an expression vector and optionally operatively linked to an expression
control sequence
appropriate for expression of the protein in a desired host. Proper assembly
can be confirmed by
nucleotide sequencing, restriction mapping, and expression of a biologically
active polypeptide
in a suitable host. As well known in the art, in order to obtain high
expression levels of a
transfected gene in a host, the gene can be operatively linked to
transcriptional and translational
expression control sequences that are functional in the chosen expression
host.
Recombinant expression vectors may be used to amplify and express DNA encoding
the
tumor specific neo-antigenic peptides. Recombinant expression vectors are
replicable DNA
constructs which have synthetic or cDNA-derived DNA fragments encoding a tumor
specific
neo-antigenic peptide or a bioequivalent analog operatively linked to suitable
transcriptional or
translational regulatory elements derived from mammalian, microbial, viral or
insect genes. A
transcriptional unit generally comprises an assembly of (1) a genetic element
or elements having
a regulatory role in gene expression, for example, transcriptional promoters
or enhancers, (2) a
structural or coding sequence which is transcribed into mRNA and translated
into protein, and
(3) appropriate transcription and translation initiation and termination
sequences, as described in
detail below. Such regulatory elements can include an operator sequence to
control
transcription. The ability to replicate in a host, usually conferred by an
origin of replication, and
a selection gene to facilitate recognition of transforrnants can additionally
be incorporated. DNA
regions are operatively linked when they are functionally related to each
other. For example,
DNA for a signal peptide (secretory leader) is operatively linked to DNA for a
polypeptide if it is
expressed as a precursor which participates in the secretion of the
polypeptide; a promoter is
operatively linked to a coding sequence if it controls the transcription of
the sequence; or a
ribosome binding site is operatively linked to a coding sequence if it is
positioned so as to permit

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
translation. Generally, operatively linked means contiguous, and in the case
of secretory leaders,
means contiguous and in reading frame. Structural elements intended for use in
yeast expression
systems include a leader sequence enabling extracellular secretion of
translated protein by a host
cell. Alternatively, where recombinant protein is expressed without a leader
or transport
sequence, it can include an N-terminal methionine residue. This residue can
optionally be
subsequently cleaved from the expressed recombinant protein to provide a final
product.
The choice of expression control sequence and expression vector will depend
upon the
choice of host. A wide variety of expression host/vector combinations can be
employed. Useful
expression vectors for eukaryotic hosts, include, for example, vectors
comprising expression
control sequences from SV40, bovine papilloma virus, adenovirus and
cytomegalovirus. Useful
expression vectors for bacterial hosts include known bacterial plasmids, such
as plasmids from
Escherichia coll. including pCR 1, pBR322, pMB9 and their derivatives, wider
host range
plasmids, such as M13 and filamentous single-stranded DNA phages.
Suitable host cells for expression of a polypeptide include prokaryotes,
yeast, insect or
higher eukaryotic cells under the control of appropriate promoters.
Prokaryotes include gram
negative or gram positive organisms, for example E. coli or bacilli. Higher
eukaryotic cells
include established cell lines of mammalian origin. Cell-free translation
systems could also be
employed. Appropriate cloning and expression vectors for use with bacterial,
fungal, yeast, and
mammalian cellular hosts are well known in the art (see Pouwels et al.,
Cloning Vectors: A
Laboratory Manual, Elsevier, N.Y., 1985).
Various mammalian or insect cell culture systems are also advantageously
employed to
express recombinant protein. Expression of recombinant proteins in mammalian
cells can be
performed because such proteins are generally correctly folded, appropriately
modified and
completely functional. Examples of suitable mammalian host cell lines include
the COS-7 lines
of monkey kidney cells, described by Gluzman (Cell 23:175, 1981), and other
cell lines capable
of expressing an appropriate vector including, for example, L cells, C127,
3T3, Chinese hamster
ovary (CHO), HeLa and BHK cell lines. Mammalian expression vectors can
comprise
nontranscribed elements such as an origin of replication, a suitable promoter
and enhancer linked
to the gene to be expressed, and other 5' or 3' flanking nontranscribed
sequences, and 5' or 3'
nontran slated sequences, such as necessary ribosome binding sites, a
polyadenylation site, splice
41

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
donor and acceptor sites, and transcriptional termination sequences.
Baculovirus systems for
production of heterologous proteins in insect cells are reviewed by Luckow and
Summers,
Bio/Technology 6:47 (1988).
The proteins produced by a transformed host can be purified according to any
suitable
method. Such standard methods include chromatography (e.g., ion exchange,
affinity and sizing
column chromatography, and the like), centrifugation, differential solubility,
or by any other
standard technique for protein purification. Affinity tags such as
hexahistidine, maltose binding
domain, influenza coat sequence, glutathione-S-transferase, and the like can
be attached to the
protein to allow easy purification by passage over an appropriate affinity
column. Isolated
proteins can also be physically characterized using such techniques as
proteolysis, nuclear
magnetic resonance and x-ray crystallography.
For example, supernatants from systems which secrete recombinant protein into
culture
media can be first concentrated using a commercially available protein
concentration filter, for
example, an Amicon or Millipore Pellicon ultrafiltration unit. Following the
concentration step,
the concentrate can be applied to a suitable purification matrix.
Alternatively, an anion exchange
resin can be employed, for example, a matrix or substrate having pendant
diethylaminoethyl
(DEAE) groups. The matrices can be acrylamide, agarose, dextran, cellulose or
other types
commonly employed in protein purification. Alternatively, a cation exchange
step can be
employed. Suitable cation exchangers include various insoluble matrices
comprising sulfopropyl
or carboxymethyl groups. Finally, one or more reversed-phase high performance
liquid
chromatography (RP-HPLC) steps employing hydrophobic RP-HPLC media, e.g.,
silica gel
having pendant methyl or other aliphatic groups, can be employed to further
purify a cancer stem
cell protein-Fc composition. Some or all of the foregoing purification steps,
in various
combinations, can also be employed to provide a homogeneous recombinant
protein.
Recombinant protein produced in bacterial culture can be isolated, for
example, by initial
extraction from cell pellets, followed by one or more concentration, salting-
out, aqueous ion
exchange or size exclusion chromatography steps. High performance liquid
chromatography
(HPLC) can be employed for final purification steps. Microbial cells employed
in expression of
a recombinant protein can be disrupted by any convenient method, including
freeze-thaw
cycling, sonication, mechanical disruption, or use of cell lysing agents.
42

In Vivo Peptide/Polypeptide Synthesis
The present invention also contemplates the use of nucleic acid molecules as
vehicles for
delivering neo-antigenic peptides/polypeptides to the subject in vivo in the
form of, e.g.,
DNA/RNA vaccines (see, e.g., W02012/159643, and W02012/159754).
In one embodiment, the personalized neoplasia vaccine may include separate DNA
plasmids encoding, for example, one or more neo-antigenic
peptides/polypeptides as identified in
according to the invention. As discussed above, the exact choice of expression
vectors will
depend upon the peptide/polypeptides to be expressed, and is well within the
skill of the ordinary
artisan. The expected persistence of the DNA constructs (e.g., in an episomal,
non-replicating,
non-integrated form in the muscle cells) is expected to provide an increased
duration of
protection.
In another embodiment, the personalized neoplasia vaccine may include separate
RNA or
cDNA molecules encoding neo-antigenic peptides/polypeptides of the invention.
In another embodiment the personalized neoplasia vaccine may include a viral
based
vector for use in a human patient such as, for example, and adenovirus system
(see, e.g., Baden
et al. First-in-human evaluation of the safety and immunogenicity of a
recombinant adenovirus
serotype 26 HIV-1 Env vaccine (IPCAVD 001). J Infect Dis. 2013 Jan
15;207(2):240-7).
Pharmaceutical Compositions/Methods of Delivery
The present invention is also directed to pharmaceutical compositions
comprising an
effective amount of one or more compounds according to the present invention
(including a
pharmaceutically acceptable salt, thereof), optionally in combination with a
pharmaceutically
acceptable carrier, excipient or additive.
A "pharmaceutically acceptable derivative or prodrur means any
pharmaceutically
acceptable salt, ester, salt of an ester, or other derivative of a compound of
this invention which,
43
Date ecue/Date Received 2020-10-09

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
upon administration to a recipient, is capable of providing (directly or
indirectly) a compound of
this invention. Particularly favored derivatives and prodrugs are those that
increase the
bioavailability of the compounds of this invention when such compounds are
administered to a
mammal (e.g., by allowing an orally or ocularly administered compound to be
more readily
absorbed into the blood) or which enhance delivery of the parent compound to a
biological
compartment (e.g., the retina) relative to the parent species.
While the tumor specific neo-antigenic peptides of the invention can be
administered as
the sole active pharmaceutical agent, they can also be used in combination
with one or more
other agents and/or adjuvants. When administered as a combination, the
therapeutic agents can
be formulated as separate compositions that are given at the same time or
different times, or the
therapeutic agents can be given as a single composition.
The tumor specific neo-antigenic peptides of the present invention may be
administered
by injection, orally, parenterally, by inhalation spray, rectally, vaginally,
or topically in dosage
unit formulations containing conventional pharmaceutically acceptable
carriers, adjuvants, and
vehicles. The term parenteral as used herein includes, into a lymph node or
nodes, subcutaneous,
intravenous, intramuscular, intrasternal, infusion techniques,
intraperitoneally, eye or ocular,
intravitreal, intrabuccal, transdermal, intranasal, into the brain, including
intracranial and
intradural, into the joints, including ankles, knees, hips, shoulders, elbows,
wrists, directly into
tumors, and the like, and in suppository form.
The pharmaceutically active compounds of this invention can be processed in
accordance
with conventional methods of pharmacy to produce medicinal agents for
administration to
patients, including humans and other mammals.
Modifications of the active compound can affect the solubility,
bioavailability and rate of
metabolism of the active species, thus providing control over the delivery of
the active species.
This can easily be assessed by preparing the derivative and testing its
activity according to
known methods well within the routine practitioner's skill in the art.
Pharmaceutical compositions based upon these chemical compounds comprise the
above-
described tumor specific neo-antigenic peptides in a therapeutically effective
amount for treating
44

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
diseases and conditions (e.g., a neoplasia/tumor), which have been described
herein, optionally
in combination with a pharmaceutically acceptable additive, carrier and/or
excipient. One of
ordinary skill in the art will recognize that a therapeutically effective
amount of one of more
compounds according to the present invention will vary with the infection or
condition to be
treated, its severity, the treatment regimen to be employed, the
pharmacokinetics of the agent
used, as well as the patient (animal or human) treated.
To prepare the pharmaceutical compositions according to the present invention,
a
therapeutically effective amount of one or more of the compounds according to
the present
invention is preferably intimately admixed with a pharmaceutically acceptable
carrier according
to conventional pharmaceutical compounding techniques to produce a dose. A
carrier may take
a wide variety of forms depending on the form of preparation desired for
administration, e.g.,
ocular, oral, topical or parenteral, including gels, creams ointments, lotions
and time released
implantable preparations, among numerous others. In preparing pharmaceutical
compositions in
oral dosage form, any of the usual pharmaceutical media may be used. Thus, for
liquid oral
preparations such as suspensions, elixirs and solutions, suitable carriers and
additives including
water, glycols, oils, alcohols, flavoring agents, preservatives, coloring
agents and the like may be
used. For solid oral preparations such as powders, tablets, capsules, and for
solid preparations
such as suppositories, suitable carriers and additives including starches,
sugar carriers, such as
dextrose, mannitol, lactose and related carriers, diluents, granulating
agents, lubricants, binders,
disintegrating agents and the like may be used. If desired, the tablets or
capsules may be enteric-
coated or sustained release by standard techniques.
The active compound is included in the pharmaceutically acceptable carrier or
diluent in
an amount sufficient to deliver to a patient a therapeutically effective
amount for the desired
indication, without causing serious toxic effects in the patient treated.
Oral compositions will generally include an inert diluent or an edible
carrier. They may
be enclosed in gelatin capsules or compressed into tablets. For the purpose of
oral therapeutic
administration, the active compound or its prodrug derivative can be
incorporated with
excipients and used in the form of tablets, troches, or capsules.
Pharmaceutically compatible
binding agents, and/or adjuvant materials can be included as part of the
composition.

The tablets, pills, capsules, troches and the like can contain any of the
following
ingredients, or compounds of a similar nature: a binder such as
microcrystalline cellulose, gum
tragacanth or gelatin; an excipient such as starch or lactose, a dispersing
agent such as alginic
acid or corn starch; a lubricant such as magnesium steamte; a glidant such as
colloidal silicon
dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent
such as
peppermint, methyl salicylate, or orange flavoring. When the dosage unit form
is a capsuk, it
can contain, in addition to material-of the above type, a liquid carrier such
as a fatty oil. In
addition, dosage unit forms can contain various other materials which modify
the physical form
of the dosage unit, for example, coatings of sugar, shellac, or enteric
agents.
Formulations of the present invention suitable for oral administration may be
presented as
discrete units such as capsules, cachets or tablets each containing a
predetermined amount of the
active ingredient; as a powder or granules; as a solution or a suspension in
an aqueous liquid or a
non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in-oil
emulsion and as a
bolus, etc.
A tablet may be made by compression or molding, optionally with one or more
accessory
ingredients. Compressed tablets may be prepared by compressing in a suitable
machine the
active ingredient in a free-flowing form such as a powder or granules,
optionally mixed with a
binder, lubricant, inert diluent, preservative, surface-active or dispersing
agent. Molded tablets
may be made by molding in a suitable machine a mixture of the powdered
compound moistened
with an inert liquid diluent. The tablets optionally may be coated or scored
and may be
formulated so as to provide slow or controlled release of the active
ingredient therein.
Methods of formulating such slow or controlled release compositions of
pharmaceutically
active ingredients, are known in the art and described in several issued US
Patents, some of
which include, but are not limited to, US Patent Nos. 3,870,790; 4,226,859;
4,369,172; 4,842,866
and 5,705,190.
Coatings can be used for delivery of compounds to the intestine (see, e.g.,
U.S. Patent Nos.
6,638,534, 5,541,171, 5,217,720, and 6,569,457).
The active compound or pharmaceutically acceptable salt thereof may also be
administered as a component of an elixir, suspension, syrup, wafer, chewing
gum or the like. A
46
Date Recue/Date Received 2020-10-09

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
syrup may contain, in addition to the active compounds, sucrose or fructose as
a sweetening
agent and certain preservatives, dyes and colorings and flavors.
Solutions or suspensions used for ocular, parenteral, intradermal,
subcutaneous, or topical
application can include the following components: a sterile diluent such as
water for injection,
saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol
or other synthetic
solvents; antibacterial agents such as benzyl alcohol or methyl parabens;
antioxidants such as
ascorbic acid or sodium bisulfite; chelating agents such as
ethylenediaminetetraacetic acid;
buffers such as acetates, citrates or phosphates and agents for the adjustment
of tonicity such as
sodium chloride or dextrose.
In one embodiment, the active compounds are prepared with carriers that will
protect the
compound against rapid elimination from the body, such as a controlled release
formulation,
including implants and microencapsulated delivery systems. Biodegradable,
biocompatible
polymers can be used, such as ethylene vinyl acetate, polyanhydrides,
polyglycolic acid,
collagen, polyorthoesters, polylactic acid, and polylactic-co-glycolic acid
(PLGA). Methods for
preparation of such formulations will be apparent to those skilled in the art.
A skilled artisan will recognize that in addition to tablets, other dosage
forms can be
formulated to provide slow or controlled release of the active ingredient.
Such dosage forms
include, but are not limited to, capsules, granulations and gel-caps.
Liposomal suspensions may also be pharmaceutically acceptable carriers. These
may be
prepared according to methods known to those skilled in the art. For example,
liposomal
formulations may be prepared by dissolving appropriate lipid(s) in an
inorganic solvent that is
then evaporated, leaving behind a thin film of dried lipid on the surface of
the container. An
aqueous solution of the active compound are then introduced into the
container. The container is
then swirled by hand to free lipid material from the sides of the container
and to disperse lipid
aggregates, thereby forming the liposomal suspension. Other methods of
preparation well known
by those of ordinary skill may also be used in this aspect of the present
invention.
The formulations may conveniently be presented in unit dosage form and may be
prepared by conventional pharmaceutical techniques. Such techniques include
the step of
47

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
bringing into association the active ingredient and the pharmaceutical
carrier(s) or excipient(s).
In general, the formulations are prepared by uniformly and intimately bringing
into association
the active ingredient with liquid carriers or finely divided solid carriers or
both, and then, if
necessary, shaping the product.
Formulations and compositions suitable for topical administration in the mouth
include
lozenges comprising the ingredients in a flavored basis, usually sucrose and
acacia or tragacanth;
pastilles comprising the active ingredient in an inert basis such as gelatin
and glycerin, or sucrose
and acacia; and mouthwashes comprising the ingredient to be administered in a
suitable liquid
carrier.
Formulations suitable for topical administration to the skin may be presented
as
ointments, creams, gels and pastes comprising the ingredient to be
administered in a
pharmaceutical acceptable carrier. A preferred topical delivery system is a
transdermal patch
containing the ingredient to be administered.
Formulations for rectal administration may be presented as a suppository with
a suitable
.. base comprising, for example, cocoa butter or a salicylate.
Formulations suitable for nasal administration, wherein the carrier is a
solid, include a
coarse powder having a particle size, for example, in the range of 20 to 500
microns which is
administered in the manner in which snuff is administered, i.e., by rapid
inhalation through the
nasal passage from a container of the powder held close up to the nose.
Suitable formulations.
wherein the carrier is a liquid, for administration, as for example, a nasal
spray or as nasal drops,
include aqueous or oily solutions of the active ingredient.
Formulations suitable for vaginal administration may be presented as
pessaries, tampons,
creams, gels, pastes, foams or spray formulations containing in addition to
the active ingredient
such carriers as are known in the art to be appropriate.
The parenteral preparation can be enclosed in ampoules, disposable syringes or
multiple
dose vials made of glass or plastic. If administered intravenously, preferred
carriers include, for
example, physiological saline or phosphate buffered saline (PBS).
48

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
For parenteral formulations, the carrier will usually comprise sterile water
or aqueous
sodium chloride solution, though other ingredients including those which aid
dispersion may be
included. Of course, where sterile water is to be used and maintained as
sterile, the compositions
and carriers will also be sterilized. Injectable suspensions may also be
prepared, in which case
appropriate liquid carriers, suspending agents and the like may be employed.
Formulations suitable for parenteral administration include aqueous and non-
aqueous
sterile injection solutions which may contain antioxidants, buffers,
bacteriostats and solutes
which render the formulation isotonic with the blood of the intended
recipient: and aqueous and
non-aqueous sterile suspensions which may include suspending agents and
thickening agents.
The formulations may be presented in unit-dose or multi-dose containers, for
example, sealed
ampules and vials, and may be stored in a freeze-dried (lyophilized) condition
requiring only the
addition of the sterile liquid carrier, for example, water for injections,
immediately prior to use.
Extemporaneous injection solutions and suspensions may be prepared from
sterile powders,
granules and tablets of the kind previously described.
Administration of the active compound may range from continuous (intravenous
drip) to
several oral administrations per day (for example, Q.I.D.) and may include
oral, topical, eye or
ocular, parenteral, intramuscular, intravenous, sub-cutaneous, transdermal
(which may include a
penetration enhancement agent), buccal and suppository administration, among
other routes of
administration, including through an eye or ocular route.
Application of the subject therapeutics may be local, so as to be administered
at the site
of interest. Various techniques can be used for providing the subject
compositions at the site of
interest, such as injection, use of catheters, trocars, projectiles, pluronic
gel, stents, sustained
drug release polymers or other device which provides for internal access.
Where an organ or
tissue is accessible because of removal from the patient, such organ or tissue
may be bathed in a
medium containing the subject compositions, the subject compositions may be
painted onto the
organ, or may be applied in any convenient way.
The tumor specific neo-antigenic peptides may be administered through a device
suitable
for the controlled and sustained release of a composition effective in
obtaining a desired local or
systemic physiological or pharmacological effect. The method includes
positioning the sustained
49

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
released drug delivery system at an area wherein release of the agent is
desired and allowing the
agent to pass through the device to the desired area of treatment.
The tumor specific neo-antigenic peptides may be utilized in combination with
at least
one known other therapeutic agent, or a pharmaceutically acceptable salt of
said agent. Examples
of known therapeutic agents which can be used for combination therapy include,
but are not
limited to, corticosteroids (e.g., cortisone, prednisone, dexamethasone), non-
steroidal anti-
inflammatory drugs (NSAIDS) (e.g., ibuprofen, celecoxib, aspirin,
indomethicin, naproxen),
alkylating agents such as busulfan, cis-platin, mitomycin C, and carboplatin;
antimitotic agents
such as colchicine, vinblastine, paclitaxel, and docetaxel; topo I inhibitors
such as camptothecin
and topotecan; topo II inhibitors such as doxorubicin and etoposide; and/or
RNA/DNA
antimetabolites such as 5-azacytidine, 5-fluorouracil and methotrexate; DNA
antimetabolites
such as 5-fluoro-T-deoxy-uridine, ara-C, hydroxyurea and thioguanine;
antibodies such as
Herceptin and Rituxan .
It should be understood that in addition to the ingredients particularly
mentioned above,
the formulations of the present invention may include other agents
conventional in the art having
regard to the type of formulation in question, for example, those suitable for
oral administration
may include flavoring agents.
In certain pharmaceutical dosage forms, the pro-drug form of the compounds may
be
preferred. One of ordinary skill in the art will recognize how to readily
modify the present
compounds to pro-drug forms to facilitate delivery of active compounds to a
targeted site within
the host organism or patient. The routine practitioner also will take
advantage of favorable
pharmacokinetic parameters of the pro-drug forms, where applicable, in
delivering the present
compounds to a targeted site within the host organism or patient to maximize
the intended effect
of the compound.
Preferred prodrugs include derivatives where a group which enhances aqueous
solubility
or active transport through the gut membrane is appended to the structure of
formulae described
herein. See, e.g., Alexander, J. et al. Journal of Medicinal Chemistry 1988,
31, 318-322;
Bundgaard, H. Design of Prodrugs; Elsevier: Amsterdam, 1985; pp 1-92;
Bundgaard, H.;
Nielsen, N. M. Journal of Medicinal Chemistry 1987, 30, 451-454; Bundgaard, H.
A Textbook

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
of Drug Design and Development; Harwood Academic Publ.: Switzerland, 1991; pp
113-191;
Digenis, G. A. et al. Handbook of Experimental Pharmacology 1975, 28, 86-112;
Friis, G. J.;
Bundgaard, H. A Textbook of Drug Design and Development; 2 ed.; Overseas
Pub!.:
Amsterdam, 1996; pp 351-385; Pitman, I. H. Medicinal Research Reviews 1981, 1,
189-214. The
prodrug forms may be active themselves, or may be those such that when
metabolized after
administration provide the active therapeutic agent in vivo.
Pharmaceutically acceptable salt forms may be the preferred chemical form of
compounds according to the present invention for inclusion in pharmaceutical
compositions
according to the present invention.
The present compounds or their derivatives, including prodrug forms of these
agents, can
be provided in the form of pharmaceutically acceptable salts. As used herein,
the term
pharmaceutically acceptable salts or complexes refers to appropriate salts or
complexes of the
active compounds according to the present invention which retain the desired
biological activity
of the parent compound and exhibit limited toxicological effects to normal
cells. Nonlimiting
examples of such salts are (a) acid addition salts formed with inorganic acids
(for example,
hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric
acid, and the like), and
salts formed with organic acids such as acetic acid, oxalic acid, tartaric
acid, succinic acid, malic
acid, ascorbic acid, benzoic acid, tannic acid, pamoic acid, alginic acid, and
polyglutamic acid,
among others; (b) base addition salts formed with metal cations such as zinc,
calcium, sodium,
.. potassium, and the like, among numerous others.
The compounds herein are commercially available or can be synthesized. As can
be
appreciated by the skilled artisan, further methods of synthesizing the
compounds of the
formulae herein will be evident to those of ordinary skill in the art.
Additionally, the various
synthetic steps may be performed in an alternate sequence or order to give the
desired
compounds. Synthetic chemistry transformations and protecting group
methodologies
(protection and deprotection) useful in synthesizing the compounds described
herein are known
in the art and include, for example, those such as described in R. Larock,
Comprehensive
Organic Transformations, 2nd. Ed., Wiley-VCH Publishers (1999); T.W. Greene
and P.G.M.
Wuts, Protective Groups in Organic Synthesis, 3rd. Ed., John Wiley and Sons
(1999); L. Fieser
51

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis, John Wiley
and Sons (1999);
and L. Paquette, ed., Encyclopedia of Reagents for Organic Synthesis, John
Wiley and Sons
(1995), and subsequent editions thereof.
The additional agents that may be included with the tumor specific neo-
antigenic peptides
of this invention may contain one or more asymmetric centers and thus occur as
racemates and
racemic mixtures, single enantiomers, individual diastereomers and
diastereomeric mixtures. All
such isomeric forms of these compounds are expressly included in the present
invention. The
compounds of this invention may also be represented in multiple tautomeric
forms, in such
instances, the invention expressly includes all tautomeric forms of the
compounds described
herein (e.g., alkylation of a ring system may result in alkylation at multiple
sites, the invention
expressly includes all such reaction products). All such isomeric forms of
such compounds are
expressly included in the present invention. All crystal forms of the
compounds described herein
are expressly included in the present invention.
Preferred unit dosage formulations are those containing a daily dose or unit,
daily sub-
dose, as hereinabove recited, or an appropriate fraction thereof, of the
administered ingredient.
The dosage regimen for treating a disorder or a disease with the tumor
specific neo-
antigenic peptides of this invention and/or compositions of this invention is
based on a variety of
factors, including the type of disease, the age, weight, sex, medical
condition of the patient, the
severity of the condition, the route of administration, and the particular
compound employed.
Thus, the dosage regimen may vary widely, but can be determined routinely
using standard
methods.
The amounts and dosage regimens administered to a subject will depend on a
number of
factors, such as the mode of administration, the nature of the condition being
treated, the body
weight of the subject being treated and the judgment of the prescribing
physician.
The amount of compound included within therapeutically active formulations
according
to the present invention is an effective amount for treating the disease or
condition. In general, a
therapeutically effective amount of the present preferred compound in dosage
form usually
ranges from slightly less than about 0.025 mg/kg/day to about 2.5 g/kg/day,
preferably about 0.1
52

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
mg/kg/day to about 100 mg/kg/day of the patient or considerably more,
depending upon the
compound used, the condition or infection treated and the route of
administration, although
exceptions to this dosage range may be contemplated by the present invention.
In its most
preferred form, compounds according to the present invention are administered
in amounts
ranging from about 1 mg/kg/day to about 100 mg/kg/day. The dosage of the
compound will
depend on the condition being treated, the particular compound, and other
clinical factors such as
weight and condition of the patient and the route of administration of the
compound. It is to be
understood that the present invention has application for both human and
veterinary use.
For oral administration to humans, a dosage of between approximately 0.1 to
100
mg/kg/day, preferably between approximately 1 and 100 mg/kg/day, is generally
sufficient.
Where drug delivery is systemic rather than topical, this dosage range
generally produces
effective blood level concentrations of active compound ranging from less than
about 0.04 to
about 400 micrograms/cc or more of blood in the patient.
The compound is conveniently administered in any suitable unit dosage form.
including
but not limited to one containing 0.001 to 3000 mg, preferably 0.05 to 500 mg
of active
ingredient per unit dosage form. An oral dosage of 10-250 mg is usually
convenient.
The concentration of active compound in the drug composition will depend on
absorption, distribution, inactivation, and excretion rates of the drug as
well as other factors
known to those of skill in the art. It is to be noted that dosage values will
also vary with the
severity of the condition to be alleviated. It is to be further understood
that for any particular
subject, specific dosage regimens should be adjusted over time according to
the individual need
and the professional judgment of the person administering or supervising the
administration of
the compositions, and that the concentration ranges set forth herein are
exemplary only and are
not intended to limit the scope or practice of the claimed composition. The
active ingredient may
be administered at once, or may be divided into a number of smaller doses to
be administered at
varying intervals of time.
In certain embodiments, the compound is administered once daily; in other
embodiments,
the compound is administered twice daily; in yet other embodiments, the
compound is
53

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
administered once every two days, once every three days, once every four days,
once every five
days, once every six days, once every seven days, once every two weeks, once
every three
weeks, once every four weeks, once every two months, once every six months, or
once per year.
The dosing interval can be adjusted according to the needs of individual
patients. For longer
intervals of administration, extended release or depot formulations can be
used.
The compounds of the invention can be used to treat diseases and disease
conditions that
are acute, and may also be used for treatment of chronic conditions. In
certain embodiments, the
compounds of the invention are administered for time periods exceeding two
weeks, three
weeks, one month, two months, three months, four months, five months, six
months, one year,
two years, three years, four years, or five years, ten years, or fifteen
years; or for example, any
time period range in days, months or years in which the low end of the range
is any time period
between 14 days and 15 years and the upper end of the range is between 15 days
and 20 years
(e.g., 4 weeks and 15 years, 6 months and 20 years). In some cases, it may be
advantageous for
the compounds of the invention to be administered for the remainder of the
patient's life. In
preferred embodiments, the patient is monitored to check the progression of
the disease or
disorder, and the dose is adjusted accordingly. In preferred embodiments,
treatment according to
the invention is effective for at least two weeks, three weeks, one month, two
months, three
months, four months, five months, six months, one year, two years, three
years, four years, or
five years, ten years, fifteen years, twenty years, or for the remainder of
the subject's life.
The invention provides for pharmaceutical compositions containing at least one
tumor
specific neo-anti gen described herein. In embodiments, the pharmaceutical
compositions contain
a pharmaceutically acceptable carrier, excipient, or diluent, which includes
any pharmaceutical
agent that does not itself induce the production of an immune response harmful
to a subject
receiving the composition, and which may be administered without undue
toxicity. As used
herein, the term "pharmaceutically acceptable" means being approved by a
regulatory agency of
the Federal or a state government or listed in the U.S. Pharmacopia, European
Pharmacopia or
other generally recognized pharmacopia for use in mammals, and more
particularly in humans.
These compositions can be useful for treating and/or preventing viral
infection and/or
autoimmune disease.
54

A thorough discussion of pharmaceutically acceptable carriers, diluents, and
other
excipients is presented in Remington 's Pharmaceutical Sciences (17th ed.,
Mack Publishing
Company) and Remington: The Science and Practice of Pharmacy (21st ed.,
Lippincott Williams
& Wilkins)..
The formulation of the pharmaceutical
composition should suit the mode of administration. In embodiments, the
pharmaceutical
composition is suitable for administration to humans, and can be sterile, non-
particulate and/or
non-pyrogenic.
Pharmaceutically acceptable carriers, excipients, or diluents include, but are
not limited,
to saline, buffered saline, dextrose, water, glycerol, ethanol, sterile
isotonic aqueous buffer, and
combinations thereof.
Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and
magnesium
stearate, as well as coloring agents, release agents, coating agents,
sweetening, flavoring and
perfuming agents, preservatives, and antioxidants can also be present in the
compositions.
Examples of pharmaceutically-acceptable antioxidants include, but are not
limited to: (1)
water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride,
sodium bisulfate,
sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble
antioxidants, such as ascorbyl
palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT),
lecithin, propyl
gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such
as citric acid,
ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric
acid, and the like.
In embodiments, the pharmaceutical composition is provided in a solid form,
such as a
lyophilized powder suitable for reconstitution, a liquid solution, suspension,
emulsion, tablet,
pill, capsule, sustained release formulation, or powder.
In embodiments, the pharmaceutical composition is supplied in liquid form, for
example,
in a sealed container indicating the quantity and concentration of the active
ingredient in the
pharmaceutical composition. In related embodiments, the liquid form of the
pharmaceutical
composition is supplied in a hermetically sealed container.
Methods for formulating the pharmaceutical compositions of the present
invention are
conventional and well known in the art (see Remington and Remington's). One of
skill in the art
Date ecue/Date Received 2020-10-09

can readily formulate a pharmaceutical composition having the desired
characteristics (e.g., route
of administration, biosafety, and release profile).
Methods for preparing the pharmaceutical compositions include the step of
bringing into
association the active ingredient with a pharmaceutically acceptable carrier
and, optionally, one
or more accessory ingredients. The pharmaceutical compositions can be prepared
by uniformly
and intimately bringing into association the active ingredient with liquid
carriers, or finely
divided solid carriers, or both, and then, if necessary, shaping the product.
Additional
methodology for preparing the pharmaceutical compositions, including the
preparation of
multilayer dosage forms, are described in Ansel's Pharmaceutical Dosage Forms
and Drug
Delivery Systems (9th ed., Lippincott Williams & Wilkins).
Pharmaceutical compositions suitable for oral administration can be in the
form of
capsules, cachets, pills, tablets, lozenges (using a flavored basis, usually
sucrose and acacia or
tragacanth), powders, granules, or as a solution or a suspension in an aqueous
or non-aqueous
liquid, or as an oil-in-water or water-in-oil liquid emulsion, or as an elixir
or syrup, or as pastilles
(using an inert base, such as gelatin and glycerin, or sucrose and acacia)
and/or as mouth washes
and the like, each containing a predetermined amount of a compound(s)
described herein, a
derivative thereof, or a pharmaceutically acceptable salt or prodrug thereof
as the active
ingredient(s). The active ingredient can also be administered as a bolus,
electuary, or paste.
In solid dosage forms for oral administration (e.g., capsules, tablets, pills,
dragees,
powders, granules and the like), the active ingredient is mixed with one or
more
pharmaceutically acceptable carriers, excipients, or diluents, such as sodium
citrate or dicalcium
phosphate, and/or any of the following: (1) fillers or extenders, such as
starches, lactose, sucrose,
glucose, mannitol, and/or silicic acid; (2) binders, such as, for example,
carboxymethylcellulose,
alginates, gelatin, polyvinyl pyrnolidone, sucrose and/or acacia; (3)
humectants, such as glycerol;
(4) disintegrating agents, such as agar-agar, calcium carbonate, potato or
tapioca starch, alginic
acid, certain silicates, and sodium carbonate; (5) solution retarding agents,
such as paraffin; (6)
absorption accelerators, such as quaternary ammonium compounds; (7) wetting
agents, such as,
for example, acetyl alcohol and glycerol monostearate; (8) absorbents, such as
kaolin and
56
Date ecue/Date Received 2020-10-09

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
bentonite clay; (9) lubricants, such a talc, calcium stearate, magnesium
stearate, solid
polyethylene glycols, sodium lauryl sulfate, and mixtures thereof; and (10)
coloring agents. In
the case of capsules, tablets, and pills, the pharmaceutical compositions can
also comprise
buffering agents. Solid compositions of a similar type can also be prepared
using fillers in soft
.. and hard-filled gelatin capsules, and excipients such as lactose or milk
sugars, as well as high
molecular weight polyethylene glycols and the like.
A tablet can be made by compression or molding, optionally with one or more
accessory
ingredients. Compressed tablets can be prepared using binders (for example,
gelatin or
hydroxypropylmethyl cellulose), lubricants, inert diluents, preservatives,
disintegrants (for
example, sodium starch glycolate or cross-linked sodium carboxymethyl
cellulose), surface-
actives. and/ or dispersing agents. Molded tablets can be made by molding in a
suitable machine
a mixture of the powdered active ingredient moistened with an inert liquid
diluent.
The tablets and other solid dosage forms, such as dragees, capsules, pills,
and granules,
can optionally be scored or prepared with coatings and shells, such as enteric
coatings and other
coatings well known in the art.
In some embodiments, in order to prolong the effect of an active ingredient,
it is desirable
to slow the absorption of the compound from subcutaneous or intramuscular
injection. This can
be accomplished by the use of a liquid suspension of crystalline or amorphous
material having
poor water solubility. The rate of absorption of the active ingredient then
depends upon its rate
.. of dissolution which, in turn, can depend upon crystal size and crystalline
form. Alternatively,
delayed absorption of a parenterally-administered active ingredient is
accomplished by
dissolving or suspending the compound in an oil vehicle. In addition,
prolonged absorption of
the injectable pharmaceutical form can be brought about by the inclusion of
agents that delay
absorption such as aluminum monostearate and gelatin.
Controlled release parenteral compositions can be in form of aqueous
suspensions,
microspheres, microcapsules, magnetic microspheres, oil solutions, oil
suspensions, emulsions,
or the active ingredient can be incorporated in biocompatible carrier(s),
liposomes, nanoparticles,
implants or infusion devices
57

Materials for use in the preparation of microspheres and/or microcapsules
include
biodegradable/bioerodible polymers such as polyglactin, poly-(isobutyl
cyanoacrylate), poly(2-
hydroxyethyl-L-glutamine) and poly(lactic acid).
Biocompatible carriers which can be used when formulating a controlled release
parenteral formulation include carbohydrates such as dextrans, proteins such
as albumin,
lipoproteins or antibodies.
Materials for use in implants can be non-biodegradable, e.g.,
polydimethylsiloxane, or
biodegradable such as, e.g., poly(caprolactone), poly(lactic acid),
poly(glycolic acid) or
poly(ortho esters).
In embodiments, the active ingredient(s) are administered by aerosol. This is
accomplished by preparing an aqueous aerosol, liposomal preparation, or solid
particles
containing the compound. A nonaqueous (e.g., fluorocarbon propellant)
suspension can be used.
The pharmaceutical composition can also be administered using a sonic
nebulizer, which would
minimize exposing the agent to shear, which can result in degradation of the
compound.
Ordinarily, an aqueous aerosol is made by formulating an aqueous solution or
suspension
of the active ingredient(s) together with conventional pharmaceutically-
acceptable carriers and
stabilizers. The carriers and stabilizers vary with the requirements of the
particular compound,
but typically include nonionic surfactants (Tweens, Pluronics, or polyethylene
glycol), innocuous
proteins like serum albumin, sorbitan esters, oleic acid, lecithin, amino
acids such as glycine,
buffers, salts, sugars or sugar alcohols. Aerosols generally are prepared from
isotonic solutions.
Dosage forms for topical or transdermal administration of an active
ingredient(s) includes
powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches
and inhalants. The
active ingredient(s) can be mixed under sterile conditions with a
pharmaceutically acceptable
camier, and with any preservatives, buffers, or propellants as appropriate.
Transdermal patches suitable for use in the present invention are disclosed in
Transdermal Drug Delivery: Developmental Issues and Research Initiatives
(Marcel Dekker
Inc., 1989) and U.S. Pat. Nos. 4,743,249, 4,906,169, 5,198,223, 4,816,540,
5,422,119, 5,023,084.
The transdermal patch can also be any transdennal
58
Date Recue/Date Received 2020-10-09

patch well known in the art, including rransscrotal patches. Pharmaceutical
compositions in such
transdemial patches can contain one or more absorption enhancers or skin
permeation enhancers
well known in the art (see, e.g., U.S. Pat. Nos. 4,379,454 and 4,973,468.
Trartsdermal therapeutic systems for use in the present invention can
be based on iontophoresis, diffusion, or a combination of these two effects.
Transdermal patches have the added advantage of providing controlled delivery
of active
ingredient(s) to the body. Such dosage forms can be made by dissolving or
dispersing the active
ingredient(s) in a proper medium. Absorption enhancers can also be used to
increase the flux of
the active ingredient across the skin. The rate of such flux can be controlled
by either providing
a rate controlling membrane or dispersing the active ingredient(s) in a
polymer matrix or gel.
Such pharmaceutical compositions can be in the form of creams, ointments,
lotions,
liniments, gels, hydrogels, solutions, suspensions, sticks, sprays, pastes,
plasters and other kinds
of transdermal drug delivery systems. The compositions can also include
pharmaceutically
acceptable carriers or excipients such as emulsifying agents, antioxidants,
buffering agents,
preservatives, humectants, penetration enhancers, chelating agents, gel-
forming agents, ointment
bases, perfumes, and skin protective agents.
Examples of emulsifying agents include, but are not limited to, naturally
occurring gums,
e.g. gum acacia or gum tragacanth, naturally occurring phosphatides, e.g.
soybean lecithin and
sorbitan monooleate derivatives.
Examples of antioxidants include, but are not limited to, butylated hydroxy
anisole
(BHA), ascorbic acid and derivatives thereof, tocopherol and derivatives
thereof, and cysteine.
Examples of preservatives include, but are not limited to, parabens, such as
methyl or
propyl p-hydroxybenzoate and benzalkonium chloride.
Examples of humectants include, but are not limited to, glycerin, propylene
glycol,
sorbitol and urea.
Examples of penetration enhancers include, but are not limited to, propylene
glycol,
DMSO, triethanolamine, N,N-dimethylacetamide, N,N-dimethylformamide, 2-
pyrmlidone and
59
Date Recue/Date Received 2020-10-09

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
derivatives thereof, tetrahydrofurfuryl alcohol, propylene glycol, diethylene
glycol monoethyl or
monomethyl ether with propylene glycol monolaurate or methyl laurate,
eucalyptol, lecithin,
Transcutol , and Azone .
Examples of chelating agents include, but are not limited to, sodium EDTA,
citric acid
and phosphoric acid.
Examples of gel forming agents include, but are not limited to, Carbopol,
cellulose
derivatives, bentonite, alginates, gelatin and polyvinylpyrrolidone.
In addition to the active ingredient(s), the ointments, pastes, creams, and
gels of the
present invention can contain excipients, such as animal and vegetable fats,
oils, waxes,
paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols,
silicones, bentonites,
silicic acid, talc and zinc oxide, or mixtures thereof.
Powders and sprays can contain excipients such as lactose, talc, silicic acid,
aluminum
hydroxide, calcium silicates and polyamide powder, or mixtures of these
substances. Sprays can
additionally contain customary propellants, such as chlorofluorohydrocarbons,
and volatile
unsubstituted hydrocarbons, such as butane and propane.
Injectable depot forms are made by forming microencapsule matrices of
compound(s) of
the invention in biodegradable polymers such as polylactide-polyglycolide.
Depending on the
ratio of compound to polymer. and the nature of the particular polymer
employed, the rate of
compound release can be controlled. Examples of other biodegradable polymers
include
poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also
prepared by
entrapping the drug in liposomes or microemulsions which are compatible with
body tissue.
Subcutaneous implants are well known in the art and are suitable for use in
the present
invention. Subcutaneous implantation methods are preferably non-irritating and
mechanically
resilient. The implants can be of matrix type, of reservoir type, or hybrids
thereof. In matrix
type devices, the carrier material can be porous or non-porous, solid or semi-
solid, and
permeable or impermeable to the active compound or compounds. The carrier
material can be
biodegradable or may slowly erode after administration. In some instances, the
matrix is non-
degradable but instead relies on the diffusion of the active compound through
the matrix for the

carrier material to degrade. Alternative subcutaneous implant methods utilize
reservoir devices
where the active compound or compounds are surrounded by a rate controlling
membrane, e.g., a
membrane independent of component concentration (possessing zero-order
kinetics). Devices
consisting of a matrix surrounded by a rate controlling membrane also suitable
for use.
Both reservoir and matrix type devices can contain materials such as
polydimethylsiloxane, such as Silastierm, or other silicone rubbers. Matrix
materials can be
insoluble polypropylene, polyethylene, polyvinyl chloride, ethylvinyl acetate,
polystyrene and
polymethacrylate, as well as glycerol esters of the glycerol paimitostearate,
glycerol stearate, and
glycerol behenate type. Materials can be hydrophobic or hydrophilic polymers
and optionally
contain solubilizing agents.
Subcutaneous implant devices can be slow-release capsules made with any
suitable
polymer, e.g., as described in U.S. Pat. Nos. 5,035,891 and 4,210,644.
In general, at least four different approaches are applicable in order to
provide rate
.. control over the release and transdermal permeation of a drug compound.
These approaches are:
membrane-moderated systems, adhesive diffusion-controlled systems, matrix
dispersion-type
systems and microreservoir systems. It is appreciated that a controlled
release percutaneous
and/or topical composition can be obtained by using a suitable mixture of
these approaches.
In a membrane-moderated system, the active ingredient is present in a
reservoir which is
totally encapsulated in a shallow compartment molded from a drug-impermeable
laminate, such
as a metallic plastic laminate, and a rate-controlling polymeric membrane such
as a microporous
or a non-porous polymeric membrane, e.g., ethylene-vinyl acetate copolymer.
The active
ingredient is released through the rate controlling polymeric membrane. In the
drug reservoir,
the active ingredient can either be dispersed in a solid polymer matrix or
suspended in an
unleachable, viscous liquid medium such as silicone fluid. On the external
surface of the
polymeric membrane, a thin layer of an adhesive polymer is applied to achieve
an intimate
contact of the transdermal system with the skin surface. The adhesive polymer
is preferably a
polymer which is hypoallergenic and compatible with the active drug substance.
61
Date Recue/Date Received 2020-10-09

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
In an adhesive diffusion-controlled system, a reservoir of the active
ingredient is formed
by directly dispersing the active ingredient in an adhesive polymer and then
by, e.g., solvent
casting, spreading the adhesive containing the active ingredient onto a flat
sheet of substantially
drug-impermeable metallic plastic backing to form a thin drug reservoir layer.
A matrix dispersion-type system is characterized in that a reservoir of the
active
ingredient is formed by substantially homogeneously dispersing the active
ingredient in a
hydrophilic or lipophilic polymer matrix. The drug-containing polymer is then
molded into disc
with a substantially well-defined surface area and controlled thickness. The
adhesive polymer is
spread along the circumference to form a strip of adhesive around the disc.
A microreservoir system can be considered as a combination of the reservoir
and matrix
dispersion type systems. In this case, the reservoir of the active substance
is formed by first
suspending the drug solids in an aqueous solution of water-soluble polymer and
then dispersing
the drug suspension in a lipophilic polymer to form a multiplicity of
unleachable, microscopic
spheres of drug reservoirs.
Any of the above-described controlled release, extended release, and sustained
release
compositions can be formulated to release the active ingredient in about 30
minutes to about 1
week, in about 30 minutes to about 72 hours, in about 30 minutes to 24 hours,
in about 30
minutes to 12 hours, in about 30 minutes to 6 hours, in about 30 minutes to 4
hours, and in about
3 hours to 10 hours. In embodiments, an effective concentration of the active
ingredient(s) is
sustained in a subject for 4 hours, 6 hours, 8 hours, 10 hours, 12 hours, 16
hours, 24 hours, 48
hours, 72 hours, or more after administration of the pharmaceutical
compositions to the subject.
Dosages
When the agents described herein are administered as pharmaceuticals to humans
or
animals, they can be given per se or as a pharmaceutical composition
containing active
ingredient in combination with a pharmaceutically acceptable carrier,
excipient, or diluent.
62

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Actual dosage levels and time course of administration of the active
ingredients in the
pharmaceutical compositions of the invention can be varied so as to obtain an
amount of the
active ingredient which is effective to achieve the desired therapeutic
response for a particular
patient, composition, and mode of administration, without being toxic to the
patient. Generally,
agents or pharmaceutical compositions of the invention are administered in an
amount sufficient
to reduce or eliminate symptoms associated with viral infection and/or
autoimmune disease.
Exemplary dose ranges include 0.01 mg to 250 mg per day, 0.01 mg to 100 mg per
day, 1
mg to 100 mg per day, 10 mg to 100 mg per day, 1 mg to 10 mg per day, and 0.01
mg to 10 mg
per day. A preferred dose of an agent is the maximum that a patient can
tolerate and not develop
serious or unacceptable side effects. In embodiments, the agent is
administered at a
concentration of about 10 micrograms to about 100 mg per kilogram of body
weight per day,
about 0.1 to about 10 mg/kg per day, or about 1.0 mg to about 10 ma/kg of body
weight per day.
In embodiments, the pharmaceutical composition comprises an agent in an amount
ranging between 1 and 10 mg, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mg.
In embodiments, the therapeutically effective dosage produces a serum
concentration of
an agent of from about 0.1 ng/ml to about 50-100 _tg/ml. The pharmaceutical
compositions
typically should provide a dosage of from about 0.001 mg to about 2000 mg of
compound per
kilogram of body weight per day. For example, dosages for systemic
administration to a human
patient can range from 1-10 tg/kg, 20-80 p.g/kg, 5-50 p g/kg, 75-150 ig/kg,
100-500 jug/kg, 250-
750 pg/kg, 500-1000 pig/kg, 1-10 mg/kg, 5-50 mg/kg, 25-75 mg/kg, 50-100 mg/kg,
100-250
mg/kg, 50-100 mg/kg, 250-500 mg/kg, 500-750 mg/kg, 750-1000 mg/kg. 1000-1500
mg/kg,
1500-2000 mg/kg, 5 mg/kg, 20 mg/kg, 50 mg/kg, 100 mg/kg, 500 mg/kg, 1000
mg/kg, 1500
mg/kg, or 2000 mg/kg. Pharmaceutical dosage unit forms are prepared to provide
from about 1
mg to about 5000 mg, for example from about 100 to about 2500 mg of the
compound or a
combination of essential ingredients per dosage unit form.
In embodiments, about 50 nM to about 11.tM of an agent is administered to a
subject. In
related embodiments, about 50-100 nM, 50-250 nM, 100-500 nM, 250-500 nM, 250-
750 nM,
500-750 nM, 500 nM to 11.IM, or 750 nM to 11.IM of an agent is administered to
a subject.
63

Determination of an effective amount is well within the capability of those
skilled in the
art, especially in light of the detailed disclosure provided herein.
Generally, an efficacious or
effective amount of an agent is determined by first administering a low dose
of the agent(s) and
then incrementally increasing the administered dose or dosages until a desired
effect (e.g., reduce
or eliminate symptoms associated with viral infection or autoimmune disease)
is observed in the
treated subject, with minimal or acceptable toxic side effects. Applicable
methods for
determining an appropriate dose and dosing schedule for administration of a
pharmaceutical
composition of the present invention are described, for example, in Goodman
and Gilman 's The
Pharmacological Basis of Therapeutics, Goodman et al., eds., 11th Edition,
McGraw-Hill 2005,
and Remington: The Science and Practice of Pharmacy, 20th and 21st Editions,
Gennaro and
University of the Sciences in Philadelphia, Eds., Lippencott Williams &
Wilkins (2003 and
2005).
Combination Therapies
The tumor specific neo-antigen peptides and pharmaceutical compositions
described
herein can also be administered in combination with another therapeutic
molecule. The
therapeutic molecule can be any compound used to mitigate neoplasia, or
symptoms thereof.
Examples of such compounds include, but are not limited to, chemotherapeutic
agents, anti¨
angiogenesis agents, checkpoint blockade antibodies or other molecules that
reduce immune-
suppression, and the like.
The tumor specific neo-antigen peptides can be administered before, during, or
after
administration of the additional therapeutic agent. In embodiments, the tumor
specific neo-antigen
peptides are administered before the first administration of the additional
therapeutic agent. In
embodiments, the tumor specific neo-antigen peptides are administered after
the first administration
of the additional therapeutic agent (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14 days or more). In
embodiments, the tumor specific neo-antigen peptides are administered
simultaneously with the
first administration of the additional therapeutic agent.
Vaccines
In an exemplary embodiment, the present invention is directed to an
immunogenic
composition, e.g., a vaccine composition capable of raising a specific T-cell
response. The
64
Date Recue/Date Received 2020-10-09

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
vaccine composition comprises mutant neo-antigenic peptides and mutant neo-
antigenic
polypeptides corresponding to tumor specific neo-antigens identified by the
methods described
herein.
A suitable vaccine will preferably contain a plurality of tumor specific neo-
antigenic
peptides. In an embodiment, the vaccine will include between 1 and 100 sets
peptides, more
preferably between 1 and 50 such peptides, even more preferably between 10 and
30 sets
peptides, even more preferably between 15 and 25 peptides. According to
another preferred
embodiment, the vaccine will include approximately 20 peptides, more
preferably 5, 6, 7, 8, 9,
10, 11, 12, 13. 14, 15, 16, 17, 18. 19, 20, 21, 22, 23, 24, 25, 26. 27, 28,
29, or 30 different
peptides, further preferred 6, 7, 8, 9, 10 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, or
25 different peptides, and most preferably 18, 19. 20, 21, 22, 23, 24, or 25
different peptides.
In one embodiment of the present invention the different tumor specific neo-
antigenic
peptides and/or polypeptides are selected for use in the neoplasia vaccine so
as to maximize the
likelihood of generating an immune attack against the neoplasia/tumor of the
patient. Without
being bound by theory, it is believed that the inclusion of a diversity of
tumor specific neo-
antigenic peptides will generate a broad scale immune attack against a
neoplasia/tumor. In one
embodiment, the selected tumor specific neo-antigenic peptides/polypeptides
are encoded by
missense mutations. In a second embodiment, the selected tumor specific neo-
antigenic
peptides/polypeptides are encoded by a combination of missense mutations and
neo0RF
mutations. In a third embodiment, the selected tumor specific neo-antigenic
peptides/polypeptides are encoded by neo0RF mutations.
In one embodiment in which the selected tumor specific neo-antigenic
peptides/polypeptides are encoded by missense mutations, the peptides and/or
polypeptides are
chosen based on their capability to associate with the particular MHC
molecules of the patient.
Peptides/polypeptides derived from neo0RF mutations can also be selected on
the basis of their
capability to associate with the particular MHC molecules of the patient, but
can also be selected
even if not predicted to associate with the particular MHC molecules of the
patient.
The vaccine composition is capable of raising a specific cytotoxic T-cells
response and/or
a specific helper T-cell response.
The vaccine composition can further comprise an adjuvant and/or a carrier.
Examples of
useful adjuvants and carriers are given herein below. The peptides and/or
polypeptides in the

composition can be associated with a carrier such as, e.g., a protein or an
antigen-presenting cell
such as e.g. a dendritic cell (DC) capable of presenting the peptide to a T-
cell.
Adjuvants are any substance whose admixture into the vaccine composition
increases or
otherwise modifies the immune response to the mutant peptide. Carriers are
scaffold structures,
for example a polypeptide or a polysaccharide, to which the neo-antigenic
peptides, is capable of
being associated. Optionally, adjuvants are conjugated covalently or non-
covalently to the
peptides or polypeptides of the invention.
The ability of an adjuvant to increase the immune response to an antigen is
typically
manifested by a significant increase in immune-mediated reaction, or reduction
in disease
symptoms. For example, an increase in humoral immunity is typically manifested
by a
significant increase in the titer of antibodies raised to the antigen, and an
increase in T-cell
activity is typically manifested in increased cell proliferation, or cellular
cytotoxicity, or cytokine
secretion. An adjuvant may also alter an immune response, for example, by
changing a primarily
humoral or Th2 response into a primarily cellular, or -rhl response.
Suitable adjuvants include, but are not limited to 1018 ISS, aluminum salts,
Amplivax,
AS15, BCG, CP-870,893, CpG7909, CyaA, dSLIM, GM-CSF, IC30, IC31, Imiquimod,
ImuFact
1MP321, IS Patch, ISS, ISCOMATRIX, Juvlmmune, LipoVac, MF59, monophosphoryl
lipid A,
Montanide IMS 1312, Montanide ISA 206, Montanide ISA 50V, Montanide ISA-51, OK-
432,
0M-174, 0M-197-MP-EC, ONTAK, PepTel® vector system. PLO microparticles,
resiquimod, SRLI72, Virosomes and other Virus-like particles, YF-17D, VEGF
trap, R848,
beta-glucan, Pam3Cys, Aquila's QS21 stimulon (Aquila Biotech, Worcester,
Mass., USA) which
is derived from saponin, mycobacterial extracts and synthetic bacterial cell
wall mimics, and
other proprietary adjuvants such as Ribi's Detox. Quil or Superfos. Several
immunological
adjuvants (e.g., MF59) specific for dendritic cells and their preparation have
been described
previously (Dupuis M, et al., Cell Immunol. 1998; 186(1): 18-27; Allison A C;
Dev Biol Stand.
1998; 92:3-11). Also cytokines may be used. Several cytokines have been
directly linked to
influencing dendritic cell migration to lymphoid tissues (e.g., TNF-alpha),
accelerating the
maturation of dendritic cells into efficient antigen-presenting cells for T-
lymphocytes (e.g., GM-
CSF, IL-1 and IL-4) (U.S. Pat. No. 5,849,589,
and acting as immunoadjuvants (e.g., IL-12) (Gabrilovich D 1, et al., J
Immunother
Emphasis Tumor Immunol. 1996 (6):414-418).
66
Date Recue/Date Received 2020-10-09

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Toll like receptors (TLRs) may also be used as adjuvants, and are important
members of
the family of pattern recognition receptors (PRRs) which recognize conserved
motifs shared by
many micro-organisms, termed "pathogen-associated molecular patterns" (PAMPS).
Recognition of these "danger signals" activates multiple elements of the
innate and adaptive
immune system. TLRs are expressed by cells of the innate and adaptive immune
systems such
as dendritic cells (DCs), macrophages, T and B cells, mast cells, and
granulocytes and are
localized in different cellular compartments, such as the plasma membrane,
lysosomes,
endosomes, and endolysosomes. Different TLRs recognize distinct PAMPS. For
example, TLR4
is activated by LPS contained in bacterial cell walls, TLR9 is activated by
unmethylated bacterial
or viral CpG DNA, and TLR3 is activated by double stranded RNA. TLR ligand
binding leads
to the activation of one or more intracellular signaling pathways, ultimately
resulting in the
production of many key molecules associated with inflammation and immunity
(particularly the
transcription factor NF-KB and the Type-I interferons). TLR mediated DC
activation leads to
enhanced DC activation, phagocytosis, upregulation of activation and co-
stimulation markers
such as CD80, CD83, and CD86, expression of CCR7 allowing migration of DC to
draining
lymph nodes and facilitating antigen presentation to T cells, as well as
increased secretion of
cytokines such as type I inteiferons, IL-12, and IL-6. All of these downstream
events are critical
for the induction of an adaptive immune response.
Among the most promising cancer vaccine adjuvants currently in clinical
development
are the TLR9 agonist CpG and the synthetic double-stranded RNA (dsRNA) TLR3
ligand poly-
ICLC. In preclinical studies poly-ICLC appears to be the most potent TLR
adjuvant when
compared to LPS and CpG due to its induction of pro-inflammatory cytokines and
lack of
stimulation of IL-10, as well as maintenance of high levels of co-stimulatory
molecules in DCs.
Furthermore, poly-ICLC was recently directly compared to CpG in non-human
primates (rhesus
macaques) as adjuvant for a protein vaccine consisting of human papillomavirus
(HPV)16
capsomers (Stahl-Hennig C, Eisenblatter M. Jasny E, et al. Synthetic double-
stranded RNAs are
adjuvants for the induction of T helper 1 and humoral immune responses to
human
papillomavirus in rhesus macaques. PLoS pathogens. Apr 2009;5(4)).
CpG immuno stimulatory oligonucleotides have also been reported to enhance the
effects
of adjuvants in a vaccine setting. Without being bound by theory, CpG
oligonucleotides act by
activating the innate (non- adaptive) immune system via Toll-like receptors
(TLR), mainly
67

CA 02908434 2015-09-30
WO 2014/168874 PCT/US2014/033185
TLR9. CpG triggered TLR9 activation enhances antigen- specific humoral and
cellular
responses to a wide variety of antigens, including peptide or protein
antigens, live or killed
viruses, dendritic cell vaccines, autologous cellular vaccines and
polysaccharide conjugates in
both prophylactic and therapeutic vaccines. More importantly, it enhances
dendritic cell
.. maturation and differentiation, resulting in enhanced activation of Thl
cells and strong cytotoxic
T- lymphocyte (CTL) generation, even in the absence of CD4 T-cell help. The
Thl bias induced
by TLR9 stimulation is maintained even in the presence of vaccine adjuvants
such as alum or
incomplete Freund's adjuvant (IFA) that normally promote a Th2 bias. CpG
oligonucleotides
show even greater adjuvant activity when formulated or co-administered with
other adjuvants or
in formulations such as microparticles, nano particles, lipid emulsions or
similar formulations,
which are especially necessary for inducing a strong response when the antigen
is relatively
weak. They also accelerate the immune response and enabled the antigen doses
to be reduced by
approximately two orders of magnitude, with comparable antibody responses to
the full-dose
vaccine without CpG in some experiments (Arthur M. Krieg, Nature Reviews, Drug
Discovery,
5, Jun. 2006, 471-484). U.S. Pat. No. 6,406,705 Bl describes the combined use
of CpG
oligonucleotides, non-nucleic acid adjuvants and an antigen to induce an
antigen- specific
immune response. A commercially available CpG TLR9 antagonist is dSLIM (double
Stem
Loop Immunomodulator) by Mologen (Berlin, GERMANY), which is a preferred
component of
the pharmaceutical composition of the present invention. Other TLR binding
molecules such as
RNA binding TLR 7, TLR 8 and/or TLR 9 may also be used.
Xanthenone derivatives such as, for example, Vadimezan or AsA404 (also known
as 5.6-
dimethylaxanthenone-4-acetic acid (DMXAA)), may also be used as adjuvants
according to
embodiments of the invention. Alternatively, such derivatives may also be
administered in
parallel to the vaccine of the invention, for example via systemic or
intratumoral delivery, to
stimulate immunity at the tumor site. Without being bound by theory, it is
believed that such
xanthenone derivatives act by stimulating interferon (IFN) production via the
stimulator of IFN
gene ISTING) receptor (see e.g., Conlon et al. (2013) Mouse, but not Human
STING, Binds and
Signals in Response to the Vascular Disrupting Agent 5,6-Dimethylxanthenone-4-
Acetic Acid,
Journal of Immunology, 190:5216-25 and Kim et al. (2013) Anticancer Flavonoids
are Mouse-
.. Selective STING Agonists, 8:1396-1401).
68

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Other examples of useful adjuvants include, but are not limited to, chemically
modified
CpGs (e.g. CpR, Idera), Poly(I:C)(e.g. polyi:Cl2U), non-CpG bacterial DNA or
RNA as well as
immunoactive small molecules and antibodies such as cyclophosphamide,
sunitinib,
bevacizumab, celebrex, NCX-4016, sildenafil, tadalafil, vardenafil, sorafinib,
XL-999, CP-
.. 547632, pazopanib, ZD2171, AZD2171, ipilimumab, tremelimumab, and SC58175,
which may
act therapeutically and/or as an adjuvant. The amounts and concentrations of
adjuvants and
additives useful in the context of the present invention can readily be
determined by the skilled
artisan without undue experimentation. Additional adjuvants include colony-
stimulating factors,
such as Granulocyte Macrophage Colony Stimulating Factor (GM-CSF,
sargramostim).
Poly-ICLC is a synthetically prepared double-stranded RNA consisting of polyI
and
polyC strands of average length of about 5000 nucleotides, which has been
stabilized to thermal
denaturation and hydrolysis by serum nucleases by the addition of polylysine
and
carboxymethylcellulose. The compound activates TLR3 and the RNA helicase-
domain of
MDA5, both members of the PAMP family, leading to DC and natural killer (NK)
cell activation
and production of a "natural mix" of type I interferons, cytokines, and
chemokines. Furthermore,
poly-ICLC exerts a more direct, broad host-targeted anti-infectious and
possibly antitumor effect
mediated by the two IFN-inducible nuclear enzyme systems, the 2',5'-OAS and
the Pl/eIF2a
kinase, also known as the PKR (4-6), as well as RIG-I belicase and MDA5.
In rodents and non-human primates, poly-ICLC was shown to enhance T cell
responses
.. to viral antigens, cross-priming, and the induction of tumor-. virus-, and
autoantigen-specific
CD8+ T-cells. In a recent study in non-human primates, poly-ICLC was found to
be essential for
the generation of antibody responses and T-cell immunity to DC targeted or non-
targeted HIV
Gag p24 protein, emphasizing its effectiveness as a vaccine adjuvant.
In human subjects, transcriptional analysis of serial whole blood samples
revealed similar
.. gene expression profiles among the 8 healthy human volunteers receiving one
single s.c.
administration of poly-ICLC and differential expression of up to 212 genes
between these 8
subjects versus 4 subjects receiving placebo. Remarkably, comparison of the
poly-ICLC gene
expression data to previous data from volunteers immunized with the highly
effective yellow
fever vaccine YF17D showed that a large number of transcriptional and signal
transduction
.. canonical pathways, including those of the innate immune system, were
similarly upregulated at
peak time points.
69

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
More recently, an immunologic analysis was reported on patients with ovarian,
fallopian
tube, and primary peritoneal cancer in second or third complete clinical
remission who were
treated on a phase 1 study of subcutaneous vaccination with synthetic
overlapping long peptides
(OLP) from the cancer testis antigen NY-ESO-1 alone or with Montanide-ISA-51,
or with 1.4
mg poly-ICLC and Montanide. The generation of NY-ES0-1-specific CD4+ and CD8'-
T-cell
and antibody responses were markedly enhanced with the addition of poly-ICLC
and Montanide
compared to OLP alone or OLP and Montanide.
A vaccine composition according to the present invention may comprise more
than one
different adjuvant. Furthermore, the invention encompasses a therapeutic
composition
comprising any adjuvant substance including any of the above or combinations
thereof. It is also
contemplated that the peptide or polypeptide, and the adjuvant can be
administered separately in
any appropriate sequence.
A carrier may be present independently of an adjuvant. The function of a
carrier can for
example be to confer stability, to increase the biological activity, or to
increase serum half-life.
Furthermore, a carrier may aid presenting peptides to T-cells. The carrier may
be any suitable
carrier known to the person skilled in the art, for example a protein or an
antigen presenting cell.
A carrier protein could be but is not limited to keyhole limpet hemocyanin,
serum proteins such
as transferrin, bovine serum albumin, human serum albumin, thyroglobulin or
ovalbumin,
immunoglobulins, or hormones, such as insulin or palmitic acid. For
immunization of humans,
the carrier may be a physiologically acceptable carrier acceptable to humans
and safe. However,
tetanus toxoid and/or diptheria toxoid are suitable carriers in one embodiment
of the invention.
Alternatively, the carrier may be dextrans for example sepharose.
Cytotoxic T-cells (CTLs) recognize an antigen in the form of a peptide bound
to an MHC
molecule rather than the intact foreign antigen itself. The MHC molecule
itself is located at the
cell surface of an antigen presenting cell. Thus, an activation of CTLs is
only possible if a
trimeric complex of peptide antigen, MHC molecule, and APC is present.
Correspondingly, it
may enhance the immune response if not only the peptide is used for activation
of CTLs, but if
additionally APCs with the respective MHC molecule are added. Therefore, in
some
embodiments the vaccine composition according to the present invention
additionally contains at
least one antigen presenting cell.

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
The antigen-presenting cell (or stimulator cell) typically has an MHC class I
or II
molecule on its surface, and in one embodiment is substantially incapable of
itself loading the
MHC class I or II molecule with the selected antigen. As is described in more
detail below, the
MHC class I or II molecule may readily be loaded with the selected antigen in
vitro.
Preferably, the antigen presenting cells are dendritic cells. Suitably, the
dendritic cells
are autologous dendritic cells that are pulsed with the neo-antigenic peptide.
The peptide may be
any suitable peptide that gives rise to an appropriate T-cell response. T-cell
therapy using
autologous dendritic cells pulsed with peptides from a tumor associated
antigen is disclosed in
Murphy et al. (1996) The Prostate 29, 371-380 and Tjua et al. (1997) The
Prostate 32, 272-278.
Thus, in one embodiment of the present invention the vaccine composition
containing at
least one antigen presenting cell is pulsed or loaded with one or more
peptides of the present
invention. Alternatively, peripheral blood mononuclear cells (PBMCs) isolated
from a patient
may be loaded with peptides ex vivo and injected back into the patient. As an
alternative the
antigen presenting cell comprises an expression construct encoding a peptide
of the present
invention. The polynucleotide may be any suitable polynucleotide and it is
preferred that it is
capable of transducing the dendritic cell, thus resulting in the presentation
of a peptide and
induction of immunity.
Therapeutic Methods
The invention further provides a method of inducing a neoplasia/tumor specific
immune
response in a subject, vaccinating against a neoplasia/tumor, treating and or
alleviating a
symptom of cancer in a subject by administering the subject a neo-antigenic
peptide or vaccine
composition of the invention.
According to the invention, the above-described cancer vaccine may be used for
a patient
that has been diagnosed as having cancer, or at risk of developing cancer. In
one embodiment,
the patient may have a solid tumor such as breast, ovarian, prostate, lung,
kidney, gastric, colon,
testicular, head and neck, pancreas, brain, melanoma, and other tumors of
tissue organs and
hematological tumors, such as lymphomas and leukemias, including acute
myelogenous
leukemia, chronic myelogenous leukemia, chronic lymphocytic leukemia, T cell
lymphocytic
leukemia, and B cell lymphomas.
The peptide or composition of the invention is administered in an amount
sufficient to
induce a CTL response.
71

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
The neo-antigenic peptide, polypeptide or vaccine composition of the invention
can be
administered alone or in combination with other therapeutic agents. The
therapeutic agent is for
example, a chemotherapeutic or biotherapeutic agent, radiation, or
immunotherapy. Any
suitable therapeutic treatment for a particular cancer may be administered.
Examples of
chemotherapeutic and biotherapeutic agents include, but are not limited to,
aldesleukin,
altretamine. amifostine, asparaginase, bleomycin, capecitabine, carboplatin,
carmustine,
cladribine, cisapride, cisplatin, cyclophosphamide, cytarabine, dacarbazine
(DTIC),
dactinomycin, docetaxel, doxorubicin, dronabinol, epoetin alpha, etoposide,
filgrastim,
fludarabine, fluorouracil, gemcitabine, granisetron, hydroxyurea, idarubicin,
ifosfamide,
interferon alpha, irinotecan, lansoprazole, levamisole. leucovorin, megestrol,
mesna,
methotrexate, metoclopramide, mitomycin, mitotane, mitoxantrone, omeprazole,
ondansetron,
paclitaxel (Taxo10), pilocarpine, prochloroperazine, rituximab, tamoxifen,
taxol, topotecan
hydrochloride, trastuzumab, vinblastine, vincristine and vinorelbine tartrate.
For prostate cancer
treatment, a preferred chemotherapeutic agent with which anti- CTLA-4 can be
combined is
paclitaxel (Taxo10).
In addition, the subject may be further administered an anti-
immunosuppressive or
immunostimulatory agent. For example, the subject is further administered an
anti-CTLA
antibody or anti-PD-1 or anti-PD-Ll. Blockade of CTLA-4 or PD-1/PD-L1 by
antibodies can
enhance the immune response to cancerous cells in the patient. In particular,
CTLA-4 blockade
has been shown effective when following a vaccination protocol (Hodi et al
2005).
The optimum amount of each peptide to be included in the vaccine composition
and the
optimum dosing regimen can be determined by one skilled in the art without
undue
experimentation. For example, the peptide or its variant may be prepared for
intravenous (i.v.)
injection, sub-cutaneous (s.c.) injection, intradermal (i.d.) injection,
intraperitoneal (i.p.)
injection, intramuscular (i.m.) injection. Preferred methods of peptide
injection include s.c, i.d.,
i.p., i.m., and i.v. Preferred methods of DNA injection include i.d., i.m.,
s.c, i.p. and i.v. For
example, doses of between 1 and 500 mg 50 [tg and 1.5 mg, preferably 10 mg to
500 pg, of
peptide or DNA may be given and will depend from the respective peptide or
DNA. Doses of
this range were successfully used in previous trials (Brunsvig P F, et al.,
Cancer Immunol
Immunother. 2006; 55(12): 1553- 1564; M. Staehler, et al., ASCO meeting 2007;
Abstract No
72

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
3017). Other methods of administration of the vaccine composition are known to
those skilled in
the art.
The inventive pharmaceutical composition may be compiled so that the
selection, number
and/or amount of peptides present in the composition is/are tissue, cancer,
and/or patient-
specific. For instance, the exact selection of peptides can be guided by
expression patterns of the
parent proteins in a given tissue to avoid side effects. The selection may be
dependent on the
specific type of cancer, the status of the disease, earlier treatment
regimens, the immune status of
the patient, and, of course, the HLA-haplotype of the patient. Furthermore,
the vaccine
according to the invention can contain individualized components, according to
personal needs
of the particular patient. Examples include varying the amounts of peptides
according to the
expression of the related neoantigen in the particular patient, unwanted side-
effects due to
personal allergies or other treatments, and adjustments for secondary
treatments following a first
round or scheme of treatment.
Pharmaceutical compositions comprising the peptide of the invention may be
administered to an individual already suffering from cancer. In therapeutic
applications,
compositions are administered to a patient in an amount sufficient to elicit
an effective CTL
response to the tumor antigen and to cure or at least partially arrest
symptoms and/or
complications. An amount adequate to accomplish this is defined as
"therapeutically effective
dose." Amounts effective for this use will depend on, e.g., the peptide
composition, the manner
of administration, the stage and severity of the disease being treated, the
weight and general state
of health of the patient, and the judgment of the prescribing physician, but
generally range for the
initial immunization (that is for therapeutic or prophylactic administration)
from about 1.01,ig to
about 50,000 lag of peptide for a 70 kg patient, followed by boosting dosages
or from about 1.0
pg to about 10,000 pg of peptide pursuant to a boosting regimen over weeks to
months
depending upon the patient's response and condition and possibly by measuring
specific CTL
activity in the patient's blood. It should be kept in mind that the peptide
and compositions of the
present invention may generally be employed in serious disease states, that
is, life-threatening or
potentially life threatening situations, especially when the cancer has
metastasized. For
therapeutic use, administration should begin as soon as possible after the
detection or surgical
removal of tumors. This is followed by boosting doses until at least symptoms
are substantially
abated and for a period thereafter.
73

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
The pharmaceutical compositions (e.g., vaccine compositions) for therapeutic
treatment
are intended for parenteral, topical, nasal, oral or local administration.
Preferably, the
pharmaceutical compositions are administered parenterally, e.g.,
intravenously, subcutaneously,
intradermally, or intramuscularly. The compositions may be administered at the
site of surgical
excision to induce a local immune response to the tumor. The invention
provides compositions
for parenteral administration which comprise a solution of the peptides and
vaccine compositions
are dissolved or suspended in an acceptable carrier, preferably an aqueous
carrier. A variety of
aqueous carriers may be used, e.g., water, buffered water, 0.9% saline, 0.3%
glycine, hyaluronic
acid and the like. These compositions may be sterilized by conventional, well
known
sterilization techniques, or may be sterile filtered. The resulting aqueous
solutions may be
packaged for use as is, or lyophilized, the lyophilized preparation being
combined with a sterile
solution prior to administration. The compositions may contain
pharmaceutically acceptable
auxiliary substances as required to approximate physiological conditions, such
as pH adjusting
and buffering agents, tonicity adjusting agents, wetting agents and the like,
for example, sodium
acetate, sodium lactate, sodium chloride, potassium chloride, calcium
chloride, sorbitan
monolaurate, triethanolamine oleate, etc.
The concentration of peptides of the invention in the pharmaceutical
formulations can
vary widely, i.e., from usually less than about 0.1%, to at least about 2% to
as much as 20% to
50% or more by weight, and will be selected primarily by fluid volumes,
viscosities, etc., in
accordance with the particular mode of administration selected.
A liposome suspension containing a peptide may be administered intravenously,
locally,
topically, etc. in a dose which varies according to, inter alia, the manner of
administration, the
peptide being delivered, and the stage of the disease being treated. For
targeting to the immune
cells, a ligand, such as, e.g., antibodies or fragments thereof specific for
cell surface
determinants of the desired immune system cells, can be incorporated into the
liposome. .
For solid compositions, conventional or nanoparticle nontoxic solid carriers
may be used
which include, for example, pharmaceutical grades of mannitol, lactose,
starch, magnesium
stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium
carbonate, and the
like. For oral administration, a pharmaceutically acceptable nontoxic
composition is formed by
incorporating any of the normally employed excipients, such as those carriers
previously listed,
74

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
and generally 10-95% of active ingredient, that is, one or more peptides of
the invention, and
more preferably at a concentration of 25%-75%.
For aerosol administration, the immunogenic peptides are preferably supplied
in finely
divided form along with a surfactant and propellant. Typical percentages of
peptides are 0.01 %-
20% by weight, preferably 1%-10%. The surfactant will, of course, be nontoxic,
and preferably
soluble in the propellant. Representative of such agents are the esters or
partial esters of fatty
acids containing from 6 to 22 carbon atoms, such as caproic, octanoic, lauric,
palmitic, stearic,
linoleic, linolenic, olesteric and oleic acids with an aliphatic polyhydric
alcohol or its cyclic
anhydride. Mixed esters, such as mixed or natural glycerides may be employed.
The surfactant
may constitute 0.1%-20% by weight of the composition, preferably 0.25-5%. The
balance of the
composition is ordinarily propellant. A carrier can also be included as
desired, as with, e.g.,
lecithin for intranasal delivery.
The peptides and polypeptides of the invention can be readily synthesized
chemically
utilizing reagents that are free of contaminating bacterial or animal
substances (Merrifield RB:
Solid phase peptide synthesis. I. The synthesis of a tetrapeptide. J. Am.
Chem. Soc. 85:2149-54,
1963).
For therapeutic or immunization purposes, nucleic acids encoding the peptide
of the
invention and optionally one or more of the peptides described herein can also
be administered to
the patient. A number of methods are conveniently used to deliver the nucleic
acids to the
patient. For instance, the nucleic acid can be delivered directly, as "naked
DNA". This approach
is described, for instance, in Wolff et al., Science 247: 1465-1468 (1990) as
well as U.S. Patent
Nos. 5,580,859 and 5,589,466. The nucleic acids can also be administered using
ballistic
delivery as described, for instance, in U.S. Patent No. 5,204,253. Particles
comprised solely of
DNA can be administered. Alternatively. DNA can be adhered to particles, such
as gold
particles.
The nucleic acids can also be delivered complexed to cationic compounds, such
as
cationic lipids. Lipid-mediated gene delivery methods are described, for
instance, in
W01996/18372; WO 1993/24640; Mannino & Gould-Fogerite , BioTechniques 6(7):
682-691
(1988); U.S. Patent No. 5,279,833; WO 1991/06309; and Feigner et al., Proc.
Natl. Acad. Sci.
USA 84: 7413-7414 (1987).

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
RNA encoding the peptide of interest can also be used for delivery (see, e.g.,
Kiken et al,
2011; Su et al, 2011).
The peptides and polypeptides of the invention can also be expressed by
attenuated viral
hosts, such as vaccinia or fowlpox. This approach involves the use of vaccinia
virus as a vector
to express nucleotide sequences that encode the peptide of the invention. Upon
introduction into
an acutely or chronically infected host or into a noninfected host, the
recombinant vaccinia virus
expresses the immunogenic peptide, and thereby elicits a host CTL response.
Vaccinia vectors
and methods useful in immunization protocols are described in, e.g., U.S.
Patent No.
4,722,848,. Another vector is BCG (Bacille Calmette Guerin). BCG vectors are
described in
Stover et al. (Nature 351:456-460 (1991)). A wide variety of other vectors
useful for therapeutic
administration or immunization of the peptides of the invention, e.g.,
Salmonella typhi vectors
and the like, will be apparent to those skilled in the art from the
description herein.
A preferred means of administering nucleic acids encoding the peptide of the
invention
uses minigene constructs encoding multiple epitopes. To create a DNA sequence
encoding the
selected CTL epitopes (minigene) for expression in human cells, the amino acid
sequences of the
epitopes are reverse translated. A human codon usage table is used to guide
the codon choice for
each amino acid. These epitope-encoding DNA sequences are directly adjoined,
creating a
continuous polypeptide sequence. To optimize expression and/or immunogenicity,
additional
elements can be incorporated into the minigene design. Examples of amino acid
sequence that
could be reverse translated and included in the minigene sequence include:
helper T lymphocyte,
epitopes, a leader (signal) sequence, and an endoplasmic reticulum retention
signal. In addition,
MHC presentation of CTL epitopes may be improved by including synthetic (e.g.
poly-alanine)
or naturally- occurring flanking sequences adjacent to the CTL epitopes.
The minigene sequence is converted to DNA by assembling oligonucleotides that
encode
.. the plus and minus strands of the minigene. Overlapping oligonucleotides
(30-100 bases long)
are synthesized, phosphorylated, purified and annealed under appropriate
conditions using well
known techniques. The ends of the oligonucleotides are joined using T4 DNA
ligase. This
synthetic minigene, encoding the CTL epitope polypeptide, can then cloned into
a desired
expression vector.
Standard regulatory sequences well known to those of skill in the art are
included in the
vector to ensure expression in the target cells. Several vector elements are
required: a promoter
76

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
with a down-stream cloning site for minigene insertion; a polyadenylation
signal for efficient
transcription termination; an E. coli origin of replication; and an E. coli
selectable marker (e.g.
ampicillin or kanamycin resistance). Numerous promoters can be used for this
purpose, e.g., the
human cytomegalovirus (hCMV) promoter. See, U.S. Patent Nos. 5,580,859 and
5,589,466 for
.. other suitable promoter sequences.
Additional vector modifications may be desired to optimize minigene expression
and
immunogenicity. In some cases, introns are required for efficient gene
expression, and one or
more synthetic or naturally-occurring introns could be incorporated into the
transcribed region of
the minigene. The inclusion of mRNA stabilization sequences can also be
considered for
increasing minigene expression. It has recently been proposed that immuno
stimulatory
sequences (ISSs or CpGs) play a role in the immunogenicity of DNA vaccines.
These
sequences could be included in the vector, outside the minigene coding
sequence, if found to
enhance immunogenicity.
In some embodiments, a bicistronic expression vector, to allow production of
the
minigene-encoded epitopes and a second protein included to enhance or decrease
immunogenicity can be used. Examples of proteins or polypeptides that could
beneficially
enhance the immune response if co-expressed include cytokines (e.g., IL2, ml
2, GM-CSF),
cytokine-inducing molecules (e.g. LeIF) or costimulatory molecules. Helper
(HTL) epitopes
could be joined to intracellular targeting signals and expressed separately
from the CTL epitopes.
This would allow direction of the HTL epitopes to a cell compartment different
than the CTL
epitopes. If required, this could facilitate more efficient entry of HTL
epitopes into the MHC
class II pathway, thereby improving CTL induction. In contrast to CTL
induction, specifically
decreasing the immune response by co-expression of immunosuppressive molecules
(e.g. TGF-
13) may be beneficial in certain diseases.
Once an expression vector is selected, the minigene is cloned into the
polylinker region
downstream of the promoter. This plasmid is transformed into an appropriate E.
coli strain, and
DNA is prepared using standard techniques. The orientation and DNA sequence of
the
minigene, as well as all other elements included in the vector, are confirmed
using restriction
mapping and DNA sequence analysis. Bacterial cells harboring the correct
plasmid can be
stored as a master cell bank and a working cell bank.
77

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Purified plasmid DNA can be prepared for injection using a variety of
formulations. The
simplest of these is reconstitution of lyophilized DNA in sterile phosphate-
buffer saline (PBS).
A variety of methods have been described, and new techniques may become
available. As noted
above, nucleic acids are conveniently formulated with cationic lipids. In
addition, glycolipids,
fusogenic liposomes, peptides and compounds referred to collectively as
protective, interactive,
non-condensing (PINC) could also be complexed to purified plasmid DNA to
influence variables
such as stability, intramuscular dispersion, or trafficking to specific organs
or cell types.
Target cell sensitization can be used as a functional assay for expression and
MHC class I
presentation of minigene-encoded CTL epitopes. The plasmid DNA is introduced
into a
mammalian cell line that is suitable as a target for standard CTL chromium
release assays. The
transfection method used will be dependent on the final formulation.
Electroporation can be
used for "naked" DNA, whereas cationic lipids allow direct in vitro
transfection. A plasmid
expressing green fluorescent protein (GFP) can be co-transfected to allow
enrichment of
transfected cells using fluorescence activated cell sorting (FACS). These
cells are then
chromium-51 labeled and used as target cells for epitope- specific CTL lines.
Cytolysis, detected
by 51 Cr release, indicates production of MHC presentation of mini gene-
encoded CTL epitopes.
In vivo immunogenicity is a second approach for functional testing of minigene
DNA
formulations. Transgenic mice expressing appropriate human MHC molecules are
immunized
with the DNA product. The dose and route of administration are formulation
dependent (e.g.
IM for DNA in PBS, IF for lipid-complexed DNA). Twenty-one days after
immunization,
splenocytes are harvested and restimulated for 1 week in the presence of
peptides encoding each
epitope being tested. These effector cells (CTLs) are assayed for cytolysis of
peptide-loaded,
chromium-51 labeled target cells using standard techniques. Lysis of target
cells sensitized by
MHC loading of peptides corresponding to minigene-encoded epitopes
demonstrates DNA
vaccine function for in vivo induction of CTLs.
Peptides may be used to elicit CTL ex vivo, as well. The resulting CTL, can be
used to
treat chronic tumors in patients that do not respond to other conventional
forms of therapy, or
will not respond to a peptide vaccine approach of therapy. Ex vivo CTL
responses to a particular
tumor antigen are induced by incubating in tissue culture the patient's CTL
precursor cells
(CTLp) together with a source of antigen-presenting cells (APC) and the
appropriate peptide.
After an appropriate incubation time (typically 1-4 weeks), in which the CTLp
are activated and
78

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
mature and expand into effector CTL, the cells are infused back into the
patient, where they will
destroy their specific target cell (i.e., a tumor cell). In order to optimize
the in vitro conditions
for the generation of specific cytotoxic T cells, the culture of stimulator
cells is maintained in an
appropriate serum-free medium.
Prior to incubation of the stimulator cells with the cells to be activated,
e.g.. precursor
CD8+ cells, an amount of antigenic peptide is added to the stimulator cell
culture, of sufficient
quantity to become loaded onto the human Class I molecules to be expressed on
the surface of
the stimulator cells. In the present invention, a sufficient amount of peptide
is an amount that
will allow about 200, and preferably 200 or more, human Class I MHC molecules
loaded with
peptide to be expressed on the surface of each stimulator cell. Preferably,
the stimulator cells are
incubated with >21ig/m1 peptide. For example, the stimulator cells are
incubates with > 3, 4, 5,
10, 15, or more 1,tg/m1 peptide.
Resting or precursor CD8+ cells are then incubated in culture with the
appropriate
stimulator cells for a time period sufficient to activate the CD8+ cells.
Preferably, the CD8+
cells are activated in an antigen- specific manner. The ratio of resting or
precursor CD8+
(effector) cells to stimulator cells may vary from individual to individual
and may further depend
upon variables such as the amenability of an individual's lymphocytes to
culturing conditions and
the nature and severity of the disease condition or other condition for which
the within-described
treatment modality is used. Preferably, however, the lymphocyte: stimulator
cell ratio is in the
range of about 30: 1 to 300: 1. The effector/stimulator culture may be
maintained for as long a
time as is necessary to stimulate a therapeutically useable or effective
number of CD8+ cells.
The induction of CTL in vitro requires the specific recognition of peptides
that are bound
to allele specific MHC class I molecules on APC. The number of specific
MHC/peptide
complexes per APC is crucial for the stimulation of CTL, particularly in
primary immune
responses. While small amounts of peptide/MHC complexes per cell are
sufficient to render a
cell susceptible to lysis by CTL, or to stimulate a secondary CTL response,
the successful
activation of a CTL precursor (pCTL) during primary response requires a
significantly higher
number of MHC/peptide complexes. Peptide loading of empty major
histocompatability
complex molecules on cells allows the induction of primary cytotoxic T
lymphocyte responses.
Since mutant cell lines do not exist for every human MHC allele, it is
advantageous to
use a technique to remove endogenous MHC- associated peptides from the surface
of APC,
79

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
followed by loading the resulting empty MHC molecules with the immunogenic
peptides of
interest. The use of non-transformed (non-tumorigenic), noninfected cells, and
preferably,
autologous cells of patients as APC is desirable for the design of CTL
induction protocols
directed towards development of ex vivo CTL therapies. This application
discloses methods for
stripping the endogenous MHC-associated peptides from the surface of APC
followed by the
loading of desired peptides.
A stable MHC class I molecule is a trimeric complex formed of the following
elements:
1) a peptide usually of 8 - 10 residues, 2) a transmembrane heavy polymorphic
protein chain
which bears the peptide-binding site in its al and a2 domains, and 3) a non-
covalently associated
non-polymorphic light chain, p2microglobuiin. Removing the bound peptides
and/or
dissociating the p2microglobulin from the complex renders the MHC class I
molecules
nonfunctional and unstable, resulting in rapid degradation. All MHC class I
molecules isolated
from PBMCs have endogenous peptides bound to them. Therefore, the first step
is to remove all
endogenous peptides bound to MHC class I molecules on the APC without causing
their
degradation before exogenous peptides can be added to them.
Two possible ways to free up MHC class I molecules of bound peptides include
lowering
the culture temperature from 37 C to 26 C overnight to destabilize
p2microglobulin and
stripping the endogenous peptides from the cell using a mild acid treatment.
The methods
release previously bound peptides into the extracellular environment allowing
new exogenous
peptides to bind to the empty class I molecules. The cold-temperature
incubation method
enables exogenous peptides to bind efficiently to the MHC complex, but
requires an overnight
incubation at 26 C which may slow the cell's metabolic rate. It is also likely
that cells not
actively synthesizing MHC molecules (e.g., resting PBMC) would not produce
high amounts of
empty surface MHC molecules by the cold temperature procedure.
Harsh acid stripping involves extraction of the peptides with trifluoroacetic
acid, pH 2, or
acid denaturation of the immunoaffinity purified class 1-peptide complexes.
These methods are
not feasible for CTL induction, since it is important to remove the endogenous
peptides while
preserving APC viability and an optimal metabolic state which is critical for
antigen
presentation. Mild acid solutions of pH 3 such as glycine or citrate -
phosphate buffers have been
used to identify endogenous peptides and to identify tumor associated T cell
epitopes. The
treatment is especially effective, in that only the MHC class I molecules are
destabilized (and

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
associated peptides released), while other surface antigens remain intact,
including MHC class II
molecules. Most importantly, treatment of cells with the mild acid solutions
do not affect the
cell's viability or metabolic state. The mild acid treatment is rapid since
the stripping of the
endogenous peptides occurs in two minutes at 4 C and the APC is ready to
perform its function
after the appropriate peptides are loaded. The technique is utilized herein to
make peptide-
specific APCs for the generation of primary antigen- specific CTL. The
resulting APC are
efficient in inducing peptide- specific CD8+ CTL.
Activated CD8+ cells may be effectively separated from the stimulator cells
using one of
a variety of known methods. For example, monoclonal antibodies specific for
the stimulator
cells, for the peptides loaded onto the stimulator cells, or for the CD8+
cells (or a segment
thereof) may be utilized to bind their appropriate complementary ligand.
Antibody- tagged
molecules may then be extracted from the stimulator-effector cell admixture
via appropriate
means, e.g., via well-known immunoprecipitation or immunoassay methods.
Effective, cytotoxic amounts of the activated CD8+ cells can vary between in
vitro and in
.. vivo uses, as well as with the amount and type of cells that are the
ultimate target of these killer
cells. The amount will also vary depending on the condition of the patient and
should be
determined via consideration of all appropriate factors by the practitioner.
Preferably, however,
about 1 X 106 to about 1 X 1012. more preferably about 1 X 108 to about 1 X
1011, and even more
preferably. about 1 X 109 to about 1 X 1010 activated CD8+ cells are utilized
for adult humans,
compared to about 5 X 106 - 5 X 107 cells used in mice.
Preferably, as discussed above, the activated CD8+ cells are harvested from
the cell
culture prior to administration of the CD8+ cells to the individual being
treated. It is important
to note, however, that unlike other present and proposed treatment modalities,
the present
method uses a cell culture system that is not tumorigenic. Therefore, if
complete separation of
stimulator cells and activated CD8+ cells is not achieved, there is no
inherent danger known to
be associated with the administration of a small number of stimulator cells,
whereas
administration of mammalian tumor-promoting cells may be extremely hazardous.
Methods of re-introducing cellular components are known in the art and include
procedures such as those exemplified in U.S. Patent No. 4,844,893 to Honsik,
et al. and U.S.
Patent No. 4,690,915 to Rosenberg. For example, administration of activated
CD8+ cells via
intravenous infusion is appropriate.
81

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
CD8+ cell activity may be augmented through the use of CD4+ cells. The
identification
of CD4 T+ cell epitopes for tumor antigens has attracted interest because many
immune based
therapies against cancer may be more effective if both CD8+ and CD4+ T
lymphocytes are used
to target a patient's tumor. CD4+ cells are capable of enhancing CD8 T cell
responses. Many
studies in animal models have clearly demonstrated better results when both
CD4+ and CD8+ T
cells participate in anti-tumor responses (see e.g., Nishimura et al. (1999)
Distinct role of
antigen-specific T helper type 1 (TH1) and Th2 cells in tumor eradication in
vivo. J Ex Med
190:617-27). Universal CD4+ T cell epitopes have been identified that are
applicable to
developing therapies against different types of cancer (see e.g., Kobayashi et
al. (2008) Current
Opinion in Immunology 20:221-27). For example, an HLA-DR restricted helper
peptide from
tetanus toxoid was used in melanoma vaccines to activate CD4+ T cells non-
specifically (see
e.g., Slingluff et al. (2007) Immunologic and Clinical Outcomes of a
Randomized Phase II Trial
of Two Multipeptide Vaccines for Melanoma in the Adjuvant Setting, Clinical
Cancer Research
13(21):6386-95). It is contemplated within the scope of the invention that
such CD4+ cells may
be applicable at three levels that vary in their tumor specificity: 1) a broad
level in which
universal CD4+ epitopes (e.g., tetanus toxoid) may be used to augment CD8+
cells; 2) an
intermediate level in which native, tumor-associated CD4+ epitopes may be used
to augment
CD8+ cells; and 3) a patient specific level in which neoantigen CD4+ epitopes
may be used to
augment CD8+ cells in a patient specific manner.
CD8+ cell immunity may also be generated with neo-antigen loaded dendritic
cell (DC)
vaccine. DCs are potent antigen-presenting cells that initiate T cell immunity
and can be used as
cancer vaccines when loaded with one or more peptides of interest, for
example, by direct
peptide injection. For example, patients that were newly diagnosed with
metastatic melanoma
were shown to be immunized against 3 HLA-A*0201-restricted gp100 melanoma
antigen-
derived peptides with autologous peptide pulsed CD4OUIFN-g-activated mature
DCs via an IL-
12p70-producing patient DC vaccine (see e.g., Carreno et al (2013) L-12p70-
producing patient
DC vaccine elicits Tcl-polarized immunity, Journal of Clinical Investigation,
123(8):3383-94
and Ali et al. (2009) In situ regulation of DC subsets and T cells mediates
tumor regression in
mice, Cancer Immunotherapy, 1(8):1-10). It is contemplated within the scope of
the invention
that neo-antigen loaded DCs may be prepared using the synthetic TLR 3 agonist
Polyinosinic-
Polycytidylic Acid-poly-L-lysine Carboxymethylcellulose (Poly-ICLC) to
stimulate the DCs.
82

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Poly-ICLC is a potent individual maturation stimulus for human DCs as assessed
by an
upregulation of CD83 and CD86, induction of interleukin-12 (IL-12), tumor
necrosis factor
(TNF), interferon gamma-induced protein 10 (IP-10), interleukin 1 (IL-1), and
type I interferons
(IFN), and minimal interleukin 10 (IL-10) production. DCs may be
differentiated from frozen
peripheral blood mononuclear cells (PBMCs) obtained by leukapheresis, while
PBMCs may be
isolated by Ficoll gradient centrifugation and frozen in aliquots.
Illustratively, the following 7 day activation protocol may be used. Day
1¨PBMCs are
thawed and plated onto tissue culture flasks to select for monocytes which
adhere to the plastic
surface after 1-2 hr incubation at 37 C in the tissue culture incubator. After
incubation, the
lymphocytes are washed off and the adherent monocytes are cultured for 5 days
in the presence
of interleukin-4 (IL-4) and granulocyte macrophage-colony stimulating factor
(GM-CSF) to
differentiate to immature DCs. On Day 6, immature DCs are pulsed with the
keyhole limpet
hemocyanin (KLH) protein which serves as a control for the quality of the
vaccine and may
boost the immunogenicity of the vaccine. The DCs are stimulated to mature,
loaded with peptide
antigens, and incubated overnight. On Day 7, the cells are washed, and frozen
in 1 ml aliquots
containing 4-20 x 10(6) cells using a controlled-rate freezer. Lot release
testing for the batches
of DCs may be performed to meet minimum specifications before the DCs are
injected into
patients (see e.g., Sabado et al. (2013) Preparation of tumor antigen-loaded
mature dendritic cells
for immunotherapy, J. Vis Exp. Aug 1;(78). doi: 10.3791/50085).
A DC vaccine may be incorporated into a scaffold system to facilitate delivery
to a
patient. Therapeutic treatment of a patients neoplasia with a DC vaccine may
utilize a
biomaterial system that releases factors that recruit host dendritic cells
into the device,
differentiates the resident, immature DCs by locally presenting adjuvants
(e.g., danger signals)
while releasing antigen, and promotes the release of activated, antigen loaded
DCs to the lymph
nodes (or desired site of action) where the DCs may interact with T cells to
generate a potent
cytotoxic T lymphocyte response to the cancer neo-antigens. Implantable
biomaterials may be
used to generate a potent cytotoxic T lymphocyte response against a neoplasia
in a patient
specific manner. The biomaterial-resident dendritic cells may then be
activated by exposing
them to danger signals mimicking infection, in concert with release of antigen
from the
biomaterial. The activated dendritic cells then migrate from the biomaterials
to lymph nodes to
induce a cytotoxic T effector response. This approach has previously been
demonstrated to lead
83

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
to regression of established melanoma in preclinical studies using a lysate
prepared from tumor
biopsies (see e.g., Ali et al. (2209) In situ regulation of DC subsets and T
cells mediates tumor
regression in mice, Cancer Immunotherapy 1(8):1-10; Ali et al. (2009)
Infection-mimicking
materials to program dendritic cells in situ. Nat Mater 8:151-8), and such a
vaccine is currently
being tested in a Phase I clinical trial recently initiated at the Dana-Farber
Cancer Institute. This
approach has also been shown to lead to regression of glioblastoma, as well as
the induction of a
potent memory response to prevent relapse, using the C6 rat glioma mode1.24 In
the current
proposal. The ability of such an implantable, biomatrix vaccine delivery
scaffold to amplify and
sustain tumor specific dendritic cell activation may lead to more robust anti-
tumor
immuno sensitization than can be achieved by traditional subcutaneous or intra-
nodal vaccine
administrations.
The practice of the present invention employs, unless otherwise indicated,
conventional
techniques of molecular biology (including recombinant techniques),
microbiology, cell biology,
biochemistry and immunology, which are well within the purview of the skilled
artisan. Such
techniques are explained fully in the literature, such as, "Molecular Cloning:
A Laboratory
Manual", second edition (Sambrook, 1989); "Oligonucleotide Synthesis" (Gait,
1984); "Animal
Cell Culture" (Freshney. 1987); "Methods in Enzymology" "Handbook of
Experimental
Immunology" (Wei, 1996); "Gene Transfer Vectors for Mammalian Cells" (Miller
and Cabs.
1987); "Current Protocols in Molecular Biology" (Ausubel, 1987); "PCR: The
Polymerase
Chain Reaction", (Mullis, 1994); "Current Protocols in Immunology" (Coligan,
1991). These
techniques are applicable to the production of the polynucleotides and
polypeptides of the
invention, and, as such, may be considered in making and practicing the
invention. Particularly
useful techniques for particular embodiments will be discussed in the sections
that follow.
EXAMPLES
The following examples are put forth so as to provide those of ordinary skill
in the art
with a complete disclosure and description of how to make and use the assay,
screening, and
therapeutic methods of the invention, and are not intended to limit the scope
of what the
inventors regard as their invention.
84

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
Example 1: Cancer Vaccine Testing Protocol
The above-described compositions and methods may be tested on 15 patients with
high-
risk melanoma (fully resected stages IIIB, IIIC and IVM1a,b) according to the
general flow
process shown in FIG. 2. Patients may receive a series of priming vaccinations
with a mixture of
personalized tumor-specific peptides and poly-ICLC over a 4 week period
followed by two
boosts during a maintenance phase. All vaccinations will be subcutaneously
delivered. The
vaccine will be evaluated for safety, tolerability, immune response and
clinical effect in patients
and for feasibility of producing vaccine and successfully initiating
vaccination within an
appropriate time frame. The first cohort will consist of 5 patients, and after
safety is adequately
demonstrated, an additional cohort of 10 patients may be enrolled (see, e.g.,
FIG. 3 depicting an
approach for an initial population study). Peripheral blood will be
extensively monitored for
peptide-specific T-cell responses and patients will be followed for up to two
years to assess
disease recurrence.
As described above, there is a large body of evidence in both animals and
humans that
mutated epitopes are effective in inducing an immune response and that cases
of spontaneous
tumor regression or long term survival correlate with CD8+ T-cell responses to
mutated epitopes
(Buckwalter and Srivastava PK. "It is the antigen(s), stupid" and other
lessons from over a
decade of vaccitherapy of human cancer. Seminars in immunology 20:296-300
(2008);
Karanikas et al, High frequency of cytolytic T lymphocytes directed against a
tumor-specific
mutated antigen detectable with HLA tetramers in the blood of a lung carcinoma
patient with
long survival. Cancer Res. 61:3718-3724 (2001); Lennerz et al, The response of
autologous T
cells to a human melanoma is dominated by mutated neo-antigens. Proc Natl Acad
Sci U S
A.102:16013 (2005)) and that "immunoediting" can be tracked to alterations in
expression of
dominant mutated antigens in mice and man (Matsushita et al, Cancer ex ome
analysis reveals a
T-cell-dependent mechanism of cancer immunoediting Nature 482:400 (2012);
DuPage et al,
Expression of tumor-specific antigens underlies cancer immunoediting Nature
482:405 (2012);
and Sampson et al, Immunologic escape after prolonged progression-free
survival with
epidermal growth factor receptor variant III peptide vaccination in patients
with newly diagnosed
glioblastoma J Clin Oncol. 28:4722-4729 (2010)).
Next-generation sequencing can now rapidly reveal the presence of discrete
mutations
such as coding mutations in individual tumors, most commonly single amino acid
changes (e.g.,

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
missense mutations; FIG. 4A) and less frequently novel stretches of amino
acids generated by
frame-shift insertions/deletions/gene fusions, read-through mutations in stop
codons, and
translation of improperly spliced introns (e.g., neo0RFs; FIG. 4B). Neo0RFs
are particularly
valuable as immunogens because the entirety of their sequence is completely
novel to the
immune system and so are analogous to a viral or bacterial foreign antigen.
Thus, neo0RFs: (1)
are highly specific to the tumor (i.e. there is no expression in any normal
cells); (2) can bypass
central tolerance, thereby increasing the precursor frequency of neoantigen-
specific CTLs. For
example, the power of utilizing analogous foreign sequences in a therapeutic
anti-cancer vaccine
was recently demonstrated with peptides derived from human papilloma virus
(HPV). ¨50% of
the 19 patients with pre-neoplastic, viral-induced disease who received 3 - 4
vaccinations of a
mix of HPV peptides derived from the viral oncogenes E6 and E7 maintained a
complete
response for >24 months ( Kenter et a, Vaccination against HPV-16 Oncoproteins
for Vulvar
Intraepithelial Neoplasia NEJM 361:1838 (2009)).
Sequencing technology has revealed that each tumor contains multiple, patient-
specific
mutations that alter the protein coding content of a gene. Such mutations
create altered proteins,
ranging from single amino acid changes (caused by missense mutations) to
addition of long
regions of novel amino acid sequence due to frame shifts, read-through of
termination codons or
translation of intron regions (novel open reading frame mutations; neo0RFs).
These mutated
proteins are valuable targets for the host's immune response to the tumor as,
unlike native
proteins, they are not subject to the immune-dampening effects of self-
tolerance. Therefore,
mutated proteins are more likely to be immunogenic and are also more specific
for the tumor
cells compared to normal cells of the patient.
Utilizing recently improved algorithms for predicting which missense mutations
create
strong binding peptides to the patient's cognate MHC molecules, a set of
peptides representative
of optimal mutated epitopes (both neo0RF and missense) for each patient will
be identified and
prioritized and up to 20 or more peptides will be prepared for immunization
(Zhang et al,
Machine learning competition in immunology ¨ Prediction of HLA class I binding
peptides J
Immunol Methods 374:1(2011); Lundegaard et al Prediction of epitopes using
neural network
based methods J Immunol Methods 374:26 (2011)). Peptides ¨20-35 amino acids in
length will
be synthesized because such "long" peptides undergo efficient internalization,
processing and
cross-presentation in professional antigen-presenting cells such as dendritic
cells, and have been
86

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
shown to induce CTLs in humans (Melief and van der Burg, Immunotherapy of
established (pre)
malignant disease by synthetic long peptide vaccines Nature Rev Cancer 8:351
(2008)).
In addition to a powerful and specific immunogen, an effective immune response
requires
a strong adjuvant to activate the immune system (Speiser and Romero,
Molecularly defined
vaccines for cancer immunotherapy, and protective T cell immunity Seminars in
Immunol
22:144 (2010)). For example, Toll-like receptors (TLRs) have emerged as
powerful sensors of
microbial and viral pathogen "danger signals", effectively inducing the innate
immune system,
and in turn, the adaptive immune system (Bhardwaj and Gnjatic, TLR AGONISTS:
Are They
Good Adjuvants? Cancer J. 16:382-391 (2010)). Among the TLR agonists, poly-
ICLC (a
synthetic double-stranded RNA mimic) is one of the most potent activators of
myeloid-derived
dendritic cells. In a human volunteer study, poly-ICLC has been shown to be
safe and to induce
a gene expression profile in peripheral blood cells comparable to that induced
by one of the most
potent live attenuated viral vaccines, the yellow fever vaccine YF-17D (Caskey
et al, Synthetic
double-stranded RNA induces innate immune responses similar to a live viral
vaccine in humans
J Exp Med 208:2357 (2011)). Hiltono10, a GMP preparation of poly-ICLC prepared
by
Oncovir, Inc, will be utilized as the adjuvant.
Example 2: Target Patient Population
Patients with stage IIIB, IIIC and IVM la,b, melanoma have a significant risk
of disease
recurrence and death, even with complete surgical resection of disease (Balch
et al, Final Version
of 2009 AJCC Melanoma Staging and Classification J Clin Oncol 27:6199 ¨ 6206
(2009)). An
available systemic adjuvant therapy for this patient population is interferon-
a (IFNa) which
provides a measurable but marginal benefit and is associated with significant,
frequently dose-
limiting toxicity (Kirkwood et al, Interferon alfa-2b Adjuvant Therapy of High-
Risk Resected
Cutaneous Melanoma: The Eastern Cooperative Oncology Group Trial EST 1684 J
Clin Oncol
14:7-17 (1996); Kirkwood et al , High- and Low-dose Interferon Alpha-2b in
High-Risk
Melanoma: First Analysis of Intergroup Trial E1690/S9111/C9190 J Clin Oncol
18:2444 ¨2458
(2000)). These patients are not immuno-compromised by previous cancer-directed
therapy or by
active cancer and thus represent an excellent patient population in which to
assess the safety and
immunological impact of the vaccine. Finally, current standard of care for
these patients does
87

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
not mandate any treatment following surgery, thus allowing for the 8 ¨ 10 week
window for
vaccine preparation.
The target population will be cutaneous melanoma patients with clinically
detectable,
histologically confirmed nodal (local or distant) or in transit metastasis,
who have been fully
resected and are free of disease (most of stage IIIB (because of the need to
have adequate tumor
tissue for sequencing and cell line development, patients with ulcerated
primary tumor but
micrometastatic lymph nodes (T1-4b, Nla or N2a) will be excluded.), all of
stage IIIC, and stage
IVM1a, b). These may be patients at first diagnosis or at disease recurrence
after previous
diagnosis of an earlier stage melanoma.
Tumor harvest: Patients will undergo complete resection of their primary
melanoma (if
not already removed) and all regional metastatic disease with the intent of
rendering them free of
melanoma. After adequate tumor for pathological assessment has been harvested,
remaining
tumor tissue will be placed in sterile media in a sterile container and
prepared for disaggregation.
Portions of the tumor tissue will be used for whole-exome and transcriptome
sequencing and cell
line generation and any remaining tumor will be frozen.
Normal tissue harvest: A normal tissue sample (blood or sputum sample) will be
taken
for whole exome sequencing.
Patients with clinically evident locoregional metastatic disease or fully
resectable distant
nodal, cutaneous or lung metastatic disease (but absence of unresectable
distant or visceral
metastatic disease) will be identified and enrolled on the study. Entry of
patients prior to surgery
is necessary in order to acquire fresh tumor tissue for melanoma cell line
development (to
generate target cells for in vitro cytotoxicity assays as part of the immune
monitoring plan).
Example 3: Dose and Schedule
For patients who have met all pre-treatment criteria, vaccine administration
will
commence as soon as possible after the study drug has arrived and has met
incoming
specifications. For each patient, there will be four separate study drugs,
each containing 5 of 20
patient-specific peptides. Immunizations may generally proceed according to
the schedule
shown in FIG. 5.
Patients will be treated in an outpatient clinic. Immunization on each
treatment day will
consist of four 1 ml subcutaneous injections, each into a separate extremity
in order to target
88

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
different regions of the lymphatic system to reduce antigenic competition. If
the patient has
undergone complete axillary or inguinal lymph node dissection, vaccines will
be administered
into the right or left midriff as an alternative. Each injection will consist
of 1 of the 4 study
drugs for that patient and the same study drug will be injected into the same
extremity for each
.. cycle. The composition of each 1 ml injection is:
0.75 ml study drug containing 300 pg each of 5 patient-specific peptides
0.25 ml (0.5 mg) of 2 mg/ml poly-ICLC (Hiltono10)
During the induction/priming phase, patients will be immunized on days 1, 4,
8, 15 and 22. In
the maintenance phase, patients will receive booster doses at weeks 12 and 24.
Blood samples may be obtained at multiple time points: pre- (baseline; two
samples on
different days); day 15 during priming vaccination; four weeks after the
induction/priming
vaccination (week 8); pre- (week 12) and post- (week 16) first boost; pre-
(week 24) and post-
(week 28) second boost 50 ¨ 150 ml blood will be collected for each sample
(except week 16).
The primary immunological endpoint will be at week 16, and hence patients will
undergo
leukapheresis (unless otherwise indicated based on patient and physician
assessment).
Example 4: Immune Monitoring
The immunization strategy is a "prime-boost" approach, involving an initial
series of
closely spaced immunizations to induce an immune response followed by a period
of rest to
allow memory T-cells to be established. This will be followed by a booster
immunization, and
the T-cell response 4 weeks after this boost is expected to generate the
strongest response and
will be the primary immunological endpoint. Global immunological response will
be initially
monitored using peripheral blood mononuclear cells from this time point in an
18 hr ex vivo
ELISPOT assay, stimulating with a pool of overlapping 15mer peptides (11 aa
overlap)
comprising all the immunizing epitopes. Pre-vaccination samples will be
evaluated to establish
the baseline response to this peptide pool. As warranted, additional PBMC
samples will be
evaluated to examine the kinetics of the immune response to the total peptide
mix. For patients
demonstrating responses significantly above baseline, the pool of all 15mers
will be de-
convoluted to determine which particular immunizing peptide(s) were
immunogenic. In
addition, a number of additional assays will be conducted on a case-by-case
basis for appropriate
samples:
89

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
= The entire 15mer pool or sub-pools will be used as stimulating peptides
for intracellular
cytokine staining assays to identify and quantify antigen-specific CD4+, CD8+,
central
memory and effector memory populations
= Similarly, these pools will be used to evaluate the pattern of cytokines
secreted by these
cells to determine the THl vs TH2 phenotype
= Extracellular cytokine staining and flow cytometry of unstimulated cells
will be used to
quantify Treg and myeloid-derived suppressor cells (MDSC).
= If a melanoma cell line is successfully established from a responding
patient and the
activating epitope can be identified, T-cell cytotoxicity assays will be
conducted using
the mutant and corresponding wild type peptide
= PBMC from the primary immunological endpoint will be evaluated for
"epitope
spreading" by using known melanoma tumor associated antigens as stimulants and
by
using several additional identified mutated epitopes that were not selected to
be among
the immunogens, as shown in FIG. 6.
Immuno-histochemistry of the tumor sample will be conducted to quantify CD4+,
CD8+,
MDSC, and Treg infiltrating populations.
Example 5: Clinical Efficacy in Patients with Metastatic Disease
Vaccine treatment of patients with metastatic disease is complicated by their
need for an
effective therapy for the active cancer and the consequent absence of an off
treatment time
window for vaccine preparation. Furthermore, these cancer treatments may
compromise the
patient's immune system, possibly impeding the induction of an immune
response. With these
considerations in mind, settings may be chosen where timing of vaccine
preparation fits
temporally with other standard care approaches for the particular patient
population and/or where
such standard care is demonstrably compatible with an immunotherapeutic
approach. There are
two types of settings that may be pursued:
1. Combination with checkpoint blockade: Checkpoint blockade antibodies have
emerged as an effective immunotherapy for metastatic melanoma (Hodi et al,
Improved Survival
with Ipilimumab in Patients with Metastatic Melanoma NEJM 363:711 ¨723 (2010))
and are
being actively pursued in other disease settings including non-small cell lung
cancer (NSCLC)
and renal cell carcinoma (Topalian et al, Safety, Activity, and Immune
Correlates of Anti-PD-1

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Antibody in Cancer NEJM 366:2443-2454 (2012); Brahmer et al, Safety and
Activity of Anti-
PD-L1 Antibody in Patients with Advanced Cancer NEJM 366:2455-2465(2012)).
Although the
mechanism of action is not proven, both reversal of relief from local
immunosuppression and
enhancement of an immune response are possible explanations. Integrating a
powerful vaccine
to initiate an immune response with checkpoint blockade antibodies may provide
synergies, as
observed in multiple animal studies (van Elsas et al Combination immunotherapy
of B16
melanoma using anti-cytotoxic T lymphocyte-associated antigen 4 (CTLA-4)and
granulocyte/macrophage colony-stimulating factor (GM-CSF)-producing vaccines
induces
rejection of subcutaneous and metastatic tumors accompanied by autoimmune
depigmentation J
Exp Med 190:35- 366 (1999); Li et al, Anti-programmed death-1 synergizes with
granulocyte
macrophage colony-stimulating factor ¨secreting tumor cell immunotherapy
providing
therapeutic benefit to mice with established tumors Clin Cancer Res 15:1623 ¨
1634 (2009);
Pardo11, D. M. The blockade of immune checkpoints in cancer immunotherapy
Nature Reviews
Cancer 12:252 ¨ 264 (2012); Curran et al. PD-1 and CTLA-4 combination blockade
expands
infiltrating T cells and reduces regulatory T and myeloid cells within B16
melanoma tumors.
Proc Natl Acad Sci U S A. 2010 Mar 2;107(9):4275-80; Curran et al. Tumor
vaccines expressing
flt3 ligand synergize with ctla-4 blockade to reject preimplanted tumors.
Cancer Res. 2009 Oct
1;69(19):7747-55). Patients can be immediately started on checkpoint blockade
therapy while
vaccine is being prepared and once prepared, the vaccine dosing can be
integrated with antibody
therapy, as illustrated in FIG. 7; and
2. Combination with standard treatment regimens exhibiting beneficial immune
properties.
a) Renal cell carcinoma (RCC) patients who present with metastatic disease
typically
undergo surgical de-bulking followed by systemic treatment, which is commonly
with one of the
approved tyrosine kinase inhibitors (TKI) such as sunitinib, pazopanib and
sorafenib. Of the
approved TKIs, sunitinib has been shown to increase TH1 responsiveness and
decrease Treg and
myeloid-derived suppressor cells (Finke et al, Sunitinib reverses Type-1
immune suppression
and decreases T-regulatory cells in renal cell carcinoma patients Clin Can Res
14:6674 - 6682
(2008); Terme et al, VEGFA-VEGFR pathway blockade inhibits tumor-induced
regulatory T
cell proliferation in colorectal cancer (Cancer Research Author Manuscript
published Online
(2102)). The ability to immediately treat patients with an approved therapy
that does not
91

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
compromise the immune system provides the needed window to prepare the vaccine
and could
provide synergy with a vaccine therapy. In addition, cyclophosphamide (CTX)
has been
implicated in multiple animal and human studies to have an inhibitory effect
on Treg cells and a
single dose of CTX prior to a vaccine has been recently shown to improve
survival in RCC
patients who responded to the vaccine (Walter et al, Multipeptide immune
response to a cancer
vaccine IMA901 after single-dose cyclophosphamide associates with longer
patient survival
Nature Medicine 18:1254- 1260 (2012)). Both of these immune-synergistic
approaches have
been utilized in a recently completed phase 3 study of a native peptide
vaccine in RCC
(ClinicalTrials.gov, NCT01265901 EVIA901 in Patients Receiving Sunitinib for
Advanced/Metastatic Renal Cell Carcinoma);
b) Alternatively, standard treatment of glioblastoma (GBM) involves surgery,
recovery
and follow-up radiation and low dose temozolomide (TMZ) followed by a four
week rest period
before initiating standard dose TMZ. This standard treatment provides a window
for vaccine
preparation followed by initiation of vaccination prior to starting standard
dose TMZ.
Interestingly, in a study in metastatic melanoma, peptide vaccination during
standard dose TMZ
treatment increased the measured immune responsiveness compared to vaccination
alone,
suggesting additional synergistic benefit (Kyte et al, Telomerase peptide
vaccination combined
with temozolomide: a clinical trial in stage IV melanoma patients Clin Cancer
Res 17:4568
(2011)).
Example 6: Vaccine Preparation
Patient tumor tissue will be surgically resected, and tumor tissue will be
disaggregated
and separate portions used for DNA and RNA extraction and for patient-specific
melanoma cell
line development. DNA and/or RNA extracted from the tumor tissue will be used
for whole-
exome sequencing (e.g., by using the lumina HiSeq platform) and to determine
HLA typing
information. It is contemplated within the scope of the invention that
missense or neo0RF neo-
antigenic peptides may be directly identified by protein-based techniques
(e.g., mass
spectrometry).
Bioinformatics analysis will be conducted as follows. Sequence analysis of the
Exome
and RNA ¨ SEQ fast Q files will leverage existing bioinformatic pipelines that
have been used
and validated extensively in large-scale projects such as the TCGA for many
patient samples
92

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
(e.g., Chapman et al, 2011, Stransky et al, 2011, Berger et al, 2012). There
are two sequential
categories of analyses: data processing and cancer genome analysis.
Data processing pipeline: The Picard data processing pipeline
(picard.sourceforge.net/) was
developed by the Sequencing Platform. Raw data extracted from (e.g., Illumina)
sequencers for
each tumor and normal sample is subjected to the following processes using
various modules in
the Picard pipeline:
(i). Quality recalibration: Original base quality scores reported by the
Illumina pipeline
will be recalibrated based on the read-cycle, the lane, the flow cell tile,
the base in
question, and the preceding base.
(ii). Alignment: BWA (Li and Durbin, 2009) will be used to align read pairs to
the human
genome (hg19).
(iii). Mark duplicates: PCR and optical duplicates will be identified based on
read pair
mapping positions and marked in the final bam file.
The output of Picard is a bam file (Li et al, 2009)
(samtools.sourceforge.net/SAMl.pdf) that
stores the base sequences, quality scores, and alignment details for all reads
for the given sample.
Cancer Mutation Detection Pipeline: Tumor and matched normal bam files from
the Picard
pipeline will be analyzed as described below:
1. Quality Control
(i). Sample mix-up during sequencing will be done by comparing initial SNP
fingerprinting done on a sample at a few dozen sites with exome sequencing
pileups
at those sites.
(ii). Intra-sample tumor/normal mixup will be checked by first comparing the
insert
size distribution of lanes that correspond to the same library for both tumor
and
normal samples, and discarding those lanes that have a different distribution.
Bioinformatic analysis will be applied to tumor and matched normal exome
samples
to get the DNA copy number profiles. Tumor samples should also have more copy
number variation than the corresponding normals. Lanes corresponding to normal
93

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
samples that do not have flat profiles will be discarded, as will tumor lanes
that don't
have profiles consistent with other lanes from the same tumor sample will be
discarded.
(iii). Tumor purity and ploidy will be estimated based on the bioinformatic-
generated
copy number profiles.
(iv). ContEst (Cibulskis et al, 2011) will be used to determine the level of
cross-
sample contamination in samples.
2. Local realignment around putative indels
True somatic and germline small indels with respect to the reference genome
often
result in misalignment and miscalls of missense mutations and indels. This
will be
corrected for by doing a local realignment using the GATK IndelRealigner
module
(on the worldwide web at (www)broadinstitute.org/gatk) (McKenna et al, 2010,
Depristo et al, 2011) of all reads that map in the vicinity of putative indels
and
evaluating them comprehensively to ensure consistency and correctness of indel
calls.
3. Identification of somatic single nucleotide variations (SSNVs)
Somatic base pair substitutions will be identified by analyzing tumor and
matched
normal samples from a patient using a Bayesian statistical framework called
muTect
(Cibulskis et al, 2013). In the preprocessing step, reads with a preponderance
of low
quality bases or mismatches to the genome are filtered out. Mutect then
computes two
log-odds (LOD) scores which encapsulate confidence in presence and absence of
the
variant in the tumor and normal samples respectively. In the post-processing
stage
candidate mutations are empirically filtered by various criteria to account
for artifacts
of capture, sequencing and alignment. One such filter, for example, tests for
consistency between distributions of orientations of reads that harbor the
mutation
and the overall orientation distribution of reads that map to the locus to
ensure that
there is no strand bias. The final set of mutations will then be annotated
with the
94

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Oncotator tool by several fields including genomic region, codon, cDNA and
protein
changes.
4. Identification of somatic small insertions and deletions
The local realignment output from section 2.2 will be used to predict
candidate
somatic and germline indels based on assessment of reads supporting the
variant
exclusively in tumor or both in tumor and nomial bams respectively. Further
filtering
based on number and distribution of mismatches and base quality scores will be
done
(McKenna et al, 2010, DePristo et al. 2011). All indels will be manually
inspected
using the Integrated Genomics Viewer (Robinson et al, 2011) (on the worldwide
web
at (www)broadinstitute.org/igv) to ensure high-fidelity calls.
5. Gene fusion detection
The first step in the gene fusion detection pipeline is alignment of tumor RNA-
Seq
reads to a library of known gene sequences following by mapping of this
alignment to
genomic coordinates. The genomic mapping helps collapse multiple read pairs
that
map to different transcript variants that share exons to common genomic
locations.
The DNA aligned barn file will be queried for read pairs where the two mates
map to
two different coding regions that are either on different chromosomes or at
least 1
MB apart if on the same chromosome. It will also be required that the pair
ends
aligned in their respective genes be in the direction consistent with coding--
>coding
5'-> 3' direction of the (putative) fusion mRNA transcript. A list of gene
pairs where
there are at least two such 'chimeric' read pairs will be enumerated as the
initial
putative event list subject to further refinement. Next, all unaligned reads
will be
extracted from the original bam file, with the additional constraint that
their mates
were originally aligned and map into one of the genes in the gene pairs
obtained as
described above. An attempt will then be made to align all such originally
unaligned
reads to the custom "reference" built of all possible exon-exon junctions
(full length,

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
boundary-to-boundary, in coding 5'-> 3' direction) between the discovered gene
pairs.
If one such originally unaligned read maps (uniquely) onto a junction between
an
exon of gene X and an exon of gene Y, and its mate was indeed mapped to one of
the
genes X or Y, then such a read will be marked as a "fusion" read. Gene fusion
events
will be called in cases where there is at least one fusion read in correct
relative
orientation to its mate, without excessive number of mismatches around the
exon:exon junction and with a coverage of at least 10 bp in either gene. Gene
fusions
between highly homologous genes (ex. HLA family) are likely spurious and will
be
filtered out.
6. Estimation of clonality
Bioinformatic analysis may be used to estimate clonality of mutations. For
example, the
ABSOLUTE algorithm (Carter et al, 2012, Landau et al, 2013) may be used to
estimate
tumor purity, ploidy, absolute copy numbers and clonality of mutations.
Probability
density distributions of allelic fractions of each mutation will be generated
followed by
conversion to cancer cell fractions (CCFs) of the mutations. Mutations will be
classified
as clonal or subclonal based on whether the posterior probability of their CCF
exceeds
0.95 is greater or lesser than 0.5 respectively.
7. Quantification of expression
The TopHat suite (Langmead et al, 2009) will be used to align RNA-Seq reads
for the
tumor and matched normal barns to the hg19 genome. The quality of RNA-Seq data
will be assessed by the RNA-SeQC (DeLuca et al, 2012) package. The RSEM tool
(Li et al, 2011) will then be used to estimate gene and isoform expression
levels. The
generated reads per kilobase per million and tau estimates will be used to
prioritize
neo-antigens identified in each patient as described elsewhere.
96

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
8. Validation of mutations in RNA-Seq
Mutations that will be identified by analysis of whole exome data (section
2.3) will be
assessed for presence in the corresponding RNA-Seq tumor bam file of the
patient.
For each variant locus, a power calculation based on the beta-binomial
distribution
will be performed to ensure that there is at least 80% power to detect it in
the RNA-
Seq data. A capture identified mutation will be considered validated if there
are at
least 2 reads harboring the mutation for adequately powered sites.
Selection of Tumor-Specific Mutation-Containing Epitopes: All missense
mutations and
neo0RFs will be analyzed for the presence of mutation-containing epitopes
using the neural-
network based algorithm netMHC, provided and maintained by the Center for
Biological
Sequence Analysis, Technical University of Denmark, Netherlands. This family
of algorithms
were rated the top epitope prediction algorithms based on a competition
recently completed
among a series of related approaches (ref). The algorithms were trained using
an artificial neural
network based approach on multiple different human HLA A and B alleles
utilizing over
100,000 measured binding and non-binding interactions.
The accuracy of the algorithms were evaluated by conducting predictions from
mutations
found in CLL patients for whom the HLA allotypes were known. The included
allotypes were
A0101, A0201, A0310, A1101, A2402, A6801, B0702, B0801, B1501. Predictions
were made
for all 9mer and 10 mer peptides spanning each mutation using netMHCpan in mid-
2011.
Based on these predictions, seventy-four (74) 9mer peptides and sixty-three
(63) lOmer
peptides, most with predicted affinities below 500 nM, were synthesized and
the binding affinity
was measured using a competitive binding assay (Sette).
The predictions for these peptides were repeated in March 2013 using each of
the most
up to date versions of the netMHC servers (netMHCpan, netMHC and netMHCcons).
These
three algorithms were the top rated algorithms among a group of 20 used in a
competition in
2012 (Zhang et al). The observed binding affinities were then evaluated with
respect to each of
the new predictions. For each set of predicted and observed values, the % of
correct predictions
for each range is given, as well as the number of samples. The definition for
each range is as
follows:
97

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
0 ¨ 150 Predicted to have an affinity equal to or lower than 150 nM and
measured to
have an affinity equal to or lower than 150 nM.
0 ¨ 150*: Predicted to have an affinity equal to or lower than 150 nM and
measured to
have an affinity equal to or lower than 500 nM.
151 ¨ 500 nM: Predicted to have an affinity greater than 150 nM but equal to
or lower
than 500 nM and measured to have an affinity equal to or below 500 nM.
FN (>500 nM): False Negatives ¨ Predicted to have an affinity greater than 500
nM but
measured to have an affinity equal to or below 500 nM.
For 9mer peptides (Table 1) , there was little difference between the
algorithms, with the slightly
higher value for the 151- 500 nM range for netMHC cons not judged to be
significant because of
the low number of samples.
Table 1
.......... Range (nM) 9mer PAN 9mer netMHC 9mer CONS .......
76% 78% 76%
0-150
(33) (37) (34)
91% 89% 88%
0-150*
(33) (37) (34)
50% 50% 62%
151-500
(28) (14) (13)
38% 39% 41%
FN (>500)
(13) (23) (27)
For lOmer peptides (Table 2), again there was little difference between the
algorithms except
that netMHC produced significantly more false positives than netMHCpan or
netMMHCcons.
However, the precision of the lOmer predictions is slightly lower in the 0 ¨
150 nM and 0 ¨ 150*
nM ranges and significantly lower in the 151-500 nM range, compared to the
9mers.
98

CA 02908434 2015-09-30
WO 2014/168874 PCT/1JS2014/033185
Table 2.
Range (nM) 10mer PAN 10mer netMHC 10mer CONS .........
53% 50% 59%
0-150
(19) (16) (17)
68% 69% 76%
0450*
(19) (16) (17)
35% 42% 35%
151-500
(26) (12) (23)
11% 23% 13%
FN (>500)
(18) (35) (23)
For lOmers, only predictions in the 0 ¨ 150 nM range will be utilized due to
the lower than 50%
precision for binders in the 151-500 nM range.
The number of samples for any individual HLA allele was too small to draw any
conclusions regarding accuracy of the prediction algorithm for different
alleles. Data from the
largest available subset (0 ¨ 150* nM; 9mer) is shown in Table 3 as an
example.
Table 3
Allele Fraction
correct
A0101 2/2
A0201 9/11
A0301 5/5
A1101 4/4
A2402 0/0
A6801 3/4
B0702 4/4
B0801 1/2
B1501 2/2
Only predictions for HLA A and B alleles will be utilized as there is little
available data on
which to judge accuracy of predictions for HLA C alleles (Zhang et al).
99

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
An evaluation of melanoma sequence information and peptide binding predictions
was
conducted using information from the TCGA database. Information from 220
melanomas from
different patients revealed that on average there were approximately 450
missense and 5
neo0RFs per patient. 20 patients were selected at random and the predicted
binding affinities
were calculated for all the missense mutations using netMHC (Lundegaard et al
Prediction of
epitopes using neural network based methods J Immunol Methods 374:26 (2011)).
As the HLA
allotypes were unknown for these patients, the number of predicted binding
peptides per allotype
was adjusted based on the frequency of that allotype (Bone Marrow Registry
dataset for the
expected affected dominant population in the geographic area [Caucasian for
melanoma]) to
generate a predicted number of actionable mutant epitopes per patient. For
each of these mutant
epitopes (MUT), the corresponding native (WT) epitope binding was also
predicted. Utilizing a
single peptide for predicted missense binders with Kd < 500 nM and a WT/MUT Kd
ratio of
>5X and over-lapping peptides spanning the full length of each neo0RF, 80% (16
of 20) of
patients were predicted to have at least 20 peptides appropriate for
vaccination. For a quarter of
the patients, neo0RF peptides could constitute nearly half to all of the 20
peptides. Thus, there
is an adequate mutational load in melanoma to expect a high proportion of
patients to generate an
adequate number of immunogenic peptides.
Example 7: Prioritization of Immunizing Peptides
Peptides for immunization may be prioritized based on a number of criteria:
neo0RF vs.
missense, predicted Kd for the mutated peptide, the comparability of predicted
affinity for the
native peptide compared to the mutated peptide, whether the mutation occurs in
an oncogenic
driver gene or related pathway, and # of RNA-Seq reads (see e.g., FIG. 8).
As shown in FIG. 8, peptides derived from segments of neo0RF mutations that
are
predicted to bind (Kd < 500 nM) may be given the highest priority based on the
absence of
tolerance for these entirely novel sequences and their exquisite tumor-
specificity.
The similar class of missense mutations in which the native peptide is not
predicted to
bind (Kd > 1000 nM) and the mutated peptide is predicted to bind with
strong/moderate affinity
(Kd < 150 nM) may be given the next highest priority. This class (Group I
discussed above)
represents approximately 20% of naturally observed T-cell responses.
100

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
The third highest priority may be given to the more tightly binding (< 150 nM)
subset of
the Group II class discussed above. This class is responsible for
approximately almost 2/3 of
naturally observed T-cell responses.
All the remaining peptides derived from the neo0RF mutations may be given the
fourth
priority. Despite not being predicted to bind, these are included based on the
known false
negative rate, potential binding to HLA-C, potential for presence of Class II
epitopes and the
high value of utilizing totally foreign antigens.
The fifth priority may be given to the subset of Group II with lower predicted
binding
affinities (150 ¨ 500 nM). This class is responsible for approximately 10% of
the naturally
observed T-cell responses.
As the predicted affinity decreases, higher stringency may be applied to
expression
levels. Within each grouping, peptides may be ranked based on binding affinity
(e.g., the lowest
Kd may have the highest priority). Within a given grouping of missense
mutations, oncogenic
driver mutations may be given higher priority. A normal human peptidome
library of ¨12.6
million unique 9 and 10 mers curated from all known human protein sequences
(HG19) has been
created. Prior to final selection, any potential predicted epitopes derived
from a missense
mutation and all neo0RF regions may be screened against this library, and
perfect matches may
be excluded. As discussed below, particular peptides predicted to have
deleterious biochemical
properties may be eliminated or modified.
According to the techniques herein, RNA levels may be analyzed to assess
neoantigen
expression. For example, RNA-Seq read-count may be used as a proxy to estimate
neoantigen
expression. However, there is no currently available information to assess the
minimum RNA
expression level required in a tumor cell needed to initiate cytolysis. Even
the level of
expression from "pioneer" translation of messages destined for nonsense
mediated decay may be
sufficient for target generation. Accordingly, the techniques herein initially
set broad acceptance
limits for RNA levels that may vary inversely with the priority group. As the
predicted affinity
decreases, higher stringency may be applied to expression levels. One of skill
in the art will
appreciate that as additional information becomes available, such limits may
be adjusted.
Because of the high value of neo0RFs as targets due to their novelty and
exquisite tumor
specificity, neo0RFs with predicted binding epitopes (Kd < 500 nM) may be
utilized even if
there are no detectable mRNA molecules by RNA-Seq (Rank 1). Regions of neo0RFs
without
101

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
predicted binding epitopes (>500 nM), may generally be utilized only if some
level of RNA
expression is detected (Rank 4). All missense mutations with strong to
intermediate predicted
MHC binding affinity (<150 nM) may generally be utilized unless there were no
RNA-Seq reads
(Ranks 2 and 3). For missense mutations with lower predicted binding affinity
(150 - < 500
nM), these will likely be utilized only if a slightly higher level of RNA
expression is detected
(Rank 5).
Oncogenic drivers may represent a high priority group. For example, within a
given
grouping of missense mutations, oncogenic driver mutations may be of higher
priority. This
approach is based on the observed down-regulation of genes that are targeted
by immune
pressure (e.g., immunoediting). In contrast to other immune targets where down-
regulation may
not have a deleterious effect of cancer cell growth, continued expression of
oncogenic driver
genes may be crucial to cancer cell survival, thus shutting off a pathway of
immune escape.
Exemplary oncogenic drivers are listed in Table 3-1 (see e.g., Vogelstein et
al; GOTERM_BP
Assignment of genes to Gene Ontology Term - Biological Function on the
worldwide web at
(www)geneontology.org; BIOCARTA Assignment of genes to signaling pathways, on
the
worldwide web at (www)biocarta.com; KEGG Assignment of genes to pathways
according to
KEGG pathway database, on the worldwide web at
(www)genomejp/krgg/pathway.html;
REACTOME Assignment of genes to pathways according to REACTOME pathways and
gene
interactions, on the worldwide web at (www)reactome.org).
102

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
Table 3-1 Exemplary Oneogenie Driver Genes
Gene Gene Name # Mutated Onco- Tumor Classification*
Core Process
Symbol Tumor gene Suppressor pathway
Samples** score* Gene
score*
ABL1 c-abl oncogene 1, 851 93% 0% Oncogene Cell Cell
receptor tyrosine Cycle/Apoptosis
Survival
kinase
AKT1 v-akt murine 155 93% 1% Oncogene PI3K Cell
thymorna viral
Survival
oncogene homolog 1
ALK anaplastic lymphoma 189 72% 1% Oncogene P I3K;
RAS Cell
receptor tyrosine
Survival
kinase
AR androgen receptor 23 54% 0% Oncogene Transcriptional
Cell Fate
Regulation
BCL2 B-cell CLL/Iymphoma 45 27% 1% Oncogene Cell
Cell
2 Cycle/Apoptosis
Survival
BRAF v-raf murine sarcoma 24288 100% 0% Oncogene RAS
Cell
viral oncogene
Survival
honnolog B1
CARD11 caspase recruitment 74 30% 1% Oncogene Cell
Cell
domain family, Cycle/Apoptosis
Survival
member 11
CBL Cas-Br-M (murine) 168 57% 9% Oncogene P I3K; RAS Cell
ecotropic retroviral
Survival
transforming
sequence
CRLF2 cytokine receptor-like 10 100% 0% Oncogene STAT
Cell
factor 2
Survival
CSF1R colony stimulating 48 50% 15% Oncogene PI3K;
RAS Cell
factor 1 receptor
Survival
CTNNB1 catenin (cadherin- 3262 92% 1% Oncogene APC
Cell Fate
associated protein),
beta 1, 88kDa
DNMT1 DNA (cytosine-5+ 22 36% 5% Oncogene Chromatin Cell
Fate
methyltransferase 1 Modification
DNMT3A DNA (cytosine-5-)- 788 74% 12% Oncogene
Chromatin Cell Fate
methyltransferase 3 Modification
alpha
EGFR epidermal growth 10628 97% 0% Oncogene P I3K;
RAS Cell
factor receptor
Survival
(erythroblastic
leukemia viral (v-erb-
b) oncogene
, homolog, avian) . ERBB2 v-erb-b2 164 67% 3%
Oncogene P I3K; RAS Cell
erythroblastic
Survival
leukemia viral
oncogene homolog 2,
neuro/glioblastoma
derived oncogene
homolog (avian)
EZH2 enhancer of zeste 276 67% 12% Oncogene Chromatin Cell
Fate
homolog 2 Modification
(Drosophila)
FGFR2 fibroblast growth 121 49% 6% Oncogene PI3K;
RAS ; STAT Cell
factor receptor 2
Survival
FGFR3 fibroblast growth 2948 99% 0% Oncogene PI3K;
RAS ; STAT Cell
factor receptor 3
Survival
103

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
Gene Gene Name # Mutated Onco- Tumor Classification*
Core Process
Symbol Tumor gene Suppressor pathway
Samples** score* Gene
score*
FLT3 fms-related tyrosine 11520 98% 0% Oncogene
RAS; PI3K; STAT Cell
kinase 3
Survival
FOXL2 forkhead box L2 330 100% 0% Oncogene TGF-13 Cell
Fate
GATA2 GATA binding protein 45 53% 4% Oncogene
NOTCH, TGF-13 Cell Fate
2
GNA11 guanine nucleotide 110 92% 1% Oncogene
PI3K; RAS; MAPK Cell
binding protein (G
Survival
protein), alpha 11 (Gq
class)
GNAQ guanine nucleotide 245 95% 1% Oncogene
PI3K;RAS; MAPK Cell
binding protein (G
Survival
protein), q
polypeptide
GNAS GNAS complex locus 422 93% 2% Oncogene
APC; PI3K; TGF- Cell
13, RAS Survival/C
ell Fate
H3F3A H3 histone, family 3B 122 93% 0% Oncogene
Chromatin Cell Fate
(H3.38); H3 histone, Modification
family 3A
pseudogene; H3
histone, family 3A;
similar to H3 histone,
family 3B; similar to
histone H3.3B
HI5T1H3B histone cluster 1, H3j; 25 60%
0% Oncogene Chromatin Cell Fate
histone cluster 1, H3i; Modification
histone cluster 1,
H3h; histone cluster
1, H3g; histone
cluster 1, H3f; histone
cluster 1, H3e;
histone cluster 1,
H3d; histone cluster
1, H3c; histone
cluster 1, H3b;
histone cluster 1,
H3a; histone cluster
1, H2ad; histone
cluster 2, H3a;
histone cluster 2,
H3c; histone cluster
2, H3d
HRAS v-Ha-ras Harvey rat 812 96% 0% Oncogene
RAS Cell
sarcoma viral
Survival
oncogene homolog
IDH1 isocitrate 4509 100% 0% Oncogene Chromatin Cell
Fate
dehydrogenase 1 Modification
(NADP+), soluble
I0H2 isocitrate 1029 99% 0% Oncogene Chromatin Cell
Fate
dehydrogenase 2 Modification
(NADP+),
mitochondria!
JAK1 Janus kinase 1 61 26% 18% Oncogene STAT Cell
Survival
JAK2 Janus kinase 2 32692 100% 0% Oncogene STAT Cell
Survival
JAK3 Janus kinase 3 89 60% 6% Oncogene STAT Cell
Survival
104

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
Gene Gene Name # Mutated Onco- Tumor Classification*
Core Process
Symbol Tumor gene Suppressor pathway
Samples** score* Gene
score*
KIT similar to Mast/stem 4720 90% 0% Oncogene
PI3K; RAS; STAT Cell
cell growth factor
Survival
receptor precursor
(SCFR) (Proto-
oncogene tyrosine-
protein kinase Kit) (c-
kit) (CD117 antigen);
v-kit Hardy-
Zuckerman 4 feline
sarcoma viral
oncogene homolog
KLF4 Kruppel-like factor 4 61 80% 4% Oncogene
Transcriptional Cell Fate
Regulation; WNT
KRAS v-Ki-ras2 Kirsten rat 23261 100% 0% Oncogene RAS
Cell
sarcoma viral
Survival
oncogene homolog
MAP2K1 mitogen-activated 13 67% 0% Oncogene RAS Cell
protein kinase kinase
Survival
1
MED12 mediator complex 337 84% 0% Oncogene Cell
Cell
subunit 12
Cycle/Apoptosis; Survival
TGF-P
MET met proto-oncogene 159 61% 4% Oncogene P I3K;
RAS Cell
(hepatocyte growth
Survival
factor receptor)
MPL myeloproliferative 531 96% 0% Oncogene STAT
Cell
leukemia virus
Survival
oncogene
MYD88 myeloid 134 92% 1% Oncogene Cell Cell
differentiation
Cycle/Apoptosis Survival
primary response
gene (88)
NFE2L2 nuclear factor 102 74% 1% Oncogene Cell Cell
(erythroid-derived 2)-
Cycle/Apoptosis Survival
like 2
NRAS neuroblastoma RAS 2738 99% 0% Oncogene RAS
Cell
viral (v-ras) oncogene
Survival
homolog
PDGFRA platelet-derived 653 84% 1% Oncogene P I3K;
RAS Cell
growth factor
Survival
receptor, alpha
polypeptide
PIK3CA phosphoinositide-3- 4560 95% 1% Oncogene PI3K
Cell
kinase, catalytic,
Survival
alpha polypeptide
PPP2R1A protein phosphatase 86 85% 2%
Oncogene Cell Cell
2 (formerly 2A),
Cycle/Apoptosis Survival
regulatory subunit A,
alpha isoform
PTPN11 protein tyrosine 410 90% 0% Oncogene RAS
Cell
phosphatase, non-
Survival
receptor type 11;
similar to protein
tyrosine phosphatase,
non-receptor type 11
RET ret proto-oncogene 500 86% 1% Oncogene RAS;
PI3K Cell
Survival
105

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
Gene Gene Name # Mutated Onco- Tumor Classification*
Core Process
Symbol Tumor gene Suppressor pathway
Samples** score* Gene
score*
SETBP1 SET binding protein 1 95 25% 4% Oncogene
Chromatin Cell Fate
Modification;
Replication
SF3B1 splicing factor 3b, 516 91% 0% Oncogene
Transcriptional Cell Fate
subunit 1, 155kDa Regulation
SMO smoothened homolog 34 51% 3% Oncogene HH
Cell Fate
(Drosophila)
SPOP speckle-type POZ 35 66% 3% Oncogene Chromatin
Cell Fate
protein Modification;
HH
SRSF2 SRSF2 273 95% 2% Oncogene Transcriptional
Cell Fate
serine/arginine-rich Regulation
splicing factor 2
TSHR thyroid stimulating 301 86% 0% Oncogene
PI3K; MAPK Cell
hormone receptor
Survival
U2AF1 U2 small nuclear RNA 96 92% 1% Oncogene
Transcriptional Cell Fate
auxiliary factor 1 Regulation
Example 8: Peptide Production and Formulation
GMP neo-antigenic peptides for immunization will be prepared by chemical
synthesis
Merrifield RB: Solid phase peptide synthesis. I. The synthesis of a
tetrapeptide. J. Am. Chem.
Soc. 85:2149-54, 1963) in accordance with FDA regulations. Three development
runs have
been conducted of 20 ¨20-30mer peptides each. Each run was conducted in the
same facility and
utilized the same equipment as will be used for the GMP runs, utilizing draft
GMP batch records.
Each run successfully produced > 50 mg of each peptide, which were tested by
all currently
planned release tests (e.g., Appearance, Identify by MS, Purity by RP-HPLC,
Content by
Elemental Nitrogen, and TFA content by RP-HPLC) and met the targeted
specification where
appropriate. The products were also produced within the timeframe anticipated
for this part of
the process (approximately 4 weeks). The lyophilized bulk peptides were placed
on a long term
stability study and will be evaluated at various time points up to 12 months.
Material from these runs has been used to test the planned dissolution and
mixing
approach. Briefly, each peptide will be dissolved at high concentration (50
mg/ml) in 100%
DMSO and diluted to 2 mg/ml in an aqueous solvent. Initially, it was
anticipated that PBS
would be used as a diluent, however, a salting out of a small number of
peptides caused a visible
cloudiness. D5W (5% dextrose in water) was shown to be much more effective; 37
of 40
peptides were successfully diluted to a clear solution. The only problematic
peptides are very
hydrophobic peptides. The predicted biochemical properties of planned
immunizing peptides
106

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
will be evaluated and synthesis plans may be altered accordingly (using a
shorter peptide,
shifting the region to be synthesized in the N- or C-terminal direction around
the predicted
epitope, or potentially utilizing an alternate peptide). Ten separate peptides
in DMSO/D5W were
subjected to two freeze/thaw cycles and showed full recovery. Two individual
peptides were
dissolved in DMSO/D5W and placed on stability at two temperatures (-20 C and -
80 C). These
peptides will be evaluated (RP-HPLC, MS and pH) for up to 6 months. To date,
both peptides
are stable at the 12 week time point with additional time points at 24 weeks
to be evaluated.
As shown in FIG. 9, the design of the dosage form process is to prepare 4
pools of
patient-specific peptides consisting of 5 peptides each. A RP-HPLC assay has
been prepared and
qualified to evaluate these peptide mixes. This assay achieves good resolution
of multiple
peptides within a single mix and can also be used to quantitate individual
peptides.
Membrane filtration (0.2 lam pore size) will be used to reduce bioburden and
conduct
final filter sterilization. Four different appropriately sized filter types
were initially evaluated
and the Pall, PES filter (# 4612) was selected. To date, 4 different mixtures
of 5 different
peptides each have been prepared and individually filtered sequentially
through two PES filters.
Recovery of each individual peptide was evaluated utilizing the RP-HPLC assay.
For 18 of the
peptides, the recovery after two filtrations was >90%. For two highly
hydrophobic peptides,
the recovery was below 60% when evaluated at small scale but were nearly fully
recovered (87
and 97%) at scale. As stated above, approaches will be undertaken to limit the
hydrophobic
20 nature of the sequences selected.
GMP neo-antigenic peptides for immunization will be prepared by chemical
synthesis
Merrifield RB: Solid phase peptide synthesis. I. The synthesis of a
tetrapeptide. J. Am. Chem.
Soc. 85:2149-54, 1963) in accordance with FDA regulations.
Example 9: Endpoint Assessment
The primary immunological endpoint of this study will be the assessment of T
cell response
measured by ex vivo IFN-y ELISPOT. IFN-y secretion occurs as a result of the
recognition of
cognate peptides or mitogenic stimuli by CD4+ and/or CD8'- T ¨cells. A
multitude of different
CD4+ and CD8+ determinants will likely be presented to T cells in vivo since
the 20-30mer
peptides used for vaccination should undergo processing into smaller peptides
by antigen
presenting cells. Without being bound by theory. it is believed that the
combination of
107

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
personalized neo-antigen peptides, which are novel to the immune system and
thus not subject to
the immune-dampening effects of self-tolerance, and the powerful immune
adjuvant poly-ICLC
will induce strong CD4+ and/or CD8+ responses. The expectation is therefore
that T cell
responses are detectable ex vivo i.e. without the need for in vitro expansion
of epitope specific T
cells through short-term culture. Patients will initially be evaluated using
the total pool of
peptide immunogens as stimulant in the ELISPOT assay. For patients
demonstrating a robust
positive response, the precise immunogenic peptide(s) will be determined in
follow-up analysis.
The IFN-y ELISPOT is generally accepted as a robust and reproducible assay to
detect ex vivo T
cell activity and determine specificity. In addition to the analysis of the
magnitude and
determinant mapping of the T cell response in peripheral blood monocytes,
other aspects of the
immune response induced by the vaccine are critical and will be assessed.
These evaluations will
be performed in patients who exhibit an ex vivo IFN-y ELISPOT response in the
screening assay.
They include the evaluation of T cell subsets (Thl versus Th2, T effector
versus memory cells),
analysis of the presence and abundance of regulatory cells such as T
regulatory cells or myeloid
derived suppressor cells, and cytotoxicity assays if patient-specific melanoma
cells lines are
successfully established.
Example 10: Peptide synthesis
GMP peptides will be synthesized by standard solid phase synthetic peptide
chemistry and
purified by RP-HPLC. Each individual peptide will be analyzed by a variety of
qualified assays
to assess appearance (visual), purity (RP-HPLC), identity (by mass
spectrometry), quantity
(elemental nitrogen), and trifluoroacetate counterion (RP-HPLC) and released.
The personalized neoantigen peptides may be comprised of up to 20 distinct
peptides
unique to each patient. Each peptide may be a linear polymer of ¨20 - ¨30 L-
amino acids joined
by standard peptide bonds. The amino terminus may be a primary amine (NH2-)
and the
carboxy terminus is a carbonyl group (-COOH). The standard 20 amino acids
commonly found
in mammalian cells are utilized (alanine, arginine, asparagine, aspartic acid,
cysteine, glutamine,
glutamic acid , glycine, histidine, isoleucine, leucine lysine, methionine,
phenylalanine, proline,
serine, threonine, tryptophan, tyrosine, valine). The molecular weight of each
peptide varies
based on its length and sequence and is calculated for each peptide.
Personalized neoantigen peptides may be supplied as a box containing 2 ml Nunc
Cryo
vials with color-coded caps, each vial containing approximately 1.5 ml of a
frozen DMSO/D5W
108

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
solution containing up to 5 peptides at a concentration of 400 ug/ml. There
may be 10 ¨ 15 vials
for each of the four groups of peptides. The vials are to be stored at -80oC
until use. Ongoing
stability studies support the storage temperature and time.
Storage and Stability: The personalized neoantigen peptides are stored frozen
at -80oC.
The thawed, sterile filtered, in process intermediates and the final mixture
of personalized
neoantigen peptides and poly-ICLC can be kept at room temperature but should
be used within 4
hours.
Compatibility: The personalized neoantigen peptides will be mixed with 1/3
volume
poly-ICLC just prior to use.
Example 11: Administration
Following mixing with the personalized neo-antigenic peptides/polypeptides,
the
vaccine (e.g., peptides + poly-ICLC) is to be administered subcutaneously.
Preparation of personalized neo-antigenic peptides/polypeptides pools:
peptides will be
mixed together in 4 pools of up to 5 peptides each. The selection criteria for
each pool will be
based on the particular MHC allele to which the peptide is predicted to bind.
Pool Composition: The composition of the pools will be selected on the basis
of the
particular HLA allele to which each peptide is predicted to bind. The four
pools will be injected
into anatomic sites that drain to separate lymph node basins. This approach
was chosen in order
to potentially reduce antigenic competition between peptides binding to the
same HLA allele as
much as possible and involve a wide subset of the patient's immune system in
developing an
immune response. For each patient, peptides predicted to bind up to four
different HLA A and B
alleles will be identified. Some neo0RF derived peptides will not be
associated with any
particular HLA allele. The approach to distributing peptides to different
pools will be to spread
each set of peptides associated with a particular HLA allele over as many of
the four pools as
.. possible. It is highly likely there will be situations where there will be
more than 4 predicted
peptides for a given allele, and in these cases it will be necessary to
allocate more than one
peptide associated with a particular allele to the same pool. Those neo0RF
peptides not
associated with any particular allele will be randomly assigned to the
remaining slots. An
example is shown below:
109

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Al HLAA0101 3 peptides
42 HLA 41101 5 peptides
B1 HLA B0702 2 peptides
B2 HLA B6801 7 peptides
X NONE (neo0RF) 3 peptides
Pooll4 1 2 3 4
B2 B2 B2 B2
B2 B2 B2 A2
A2 42 42 42
Al Al Al B1
B1 X X X
Peptides predicted to bind to the same MHC allele will be placed into separate
pools
whenever possible. Some of the neo0RF peptides may not be predicted to bind to
any MHC
allele of the patient. These peptides will still be utilized however,
primarily because they are
completely novel and therefore not subject to the immune-dampening effects of
central tolerance
and therefore have a high probability of being immunogenic. Neo0RF peptides
also carry a
dramatically reduced potential for autoimmunity as there is no equivalent
molecule in any
normal cell. In addition, there can be false negatives arising from the
prediction algorithm and it
is possible that the peptide will contain a HLA class 11 epitope (HLA class II
epitopes are not
reliably predicted based on current algorithms). All peptides not identified
with a particular
HLA allele will be randomly assigned to the individual pools. The amounts of
each peptide are
predicated on a final dose of 300 p,g of each peptide per injection.
For each patient, four distinct pools (labeled "A", "B", "C" and "D") of 5
synthetic
peptides each will have been prepared manufacturer and stored at -80 C. On the
day of
immunization, the complete vaccine consisting of the peptide component(s) and
poly-ICLC will
be prepared in a laminar flow biosafety cabinet in the research pharmacy. One
vial each (A, B,
C and D) will be thawed at room temperature and moved into a biosafety cabinet
for the
remaining steps. 0.75 ml of each peptide pool will be withdrawn from the vial
into separate
syringes. Separately, four 0.25 ml (0.5 mg) aliquots of poly-ICLC will be
withdrawn into
separate syringes. The contents of each peptide-pool containing syringe will
then be gently
110

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
mixed with a 0.25 ml aliquot of poly-ICLC by syringe-to-syringe transfer. The
entire one ml of
the mixture will be used for injection. These 4 preparations will be labeled
"study drug A",
"study drug B", "study drug C", and "study drug D".
Injections: At each immunization, each of the 4 study drugs will be injected
subcutaneously into one extremity. Each individual study drug will be
administered to the same
extremity at each immunization for the entire duration of the treatment (i.e.
study drug A will be
injected into left arm on day 1, 4, 8 etc., study drug B will be injected into
right arm on days 1, 4,
8 etc.). Alternative anatomical locations for patients who are status post
complete axillary or
inguinal lymph node dissection are the left and right midriff, respectively.
Vaccine will be administered following a prime/boost schedule. Priming doses
of
vaccine will be administered on days 1, 4, 8, 15, and 22 as shown above. In
the boost phase,
vaccine will be administered on days 85 (week 13) and 169 (week 25).
All patients receiving at least one dose of vaccine will be evaluable for
toxicity. Patients
will be evaluable for immunologic activity if they have received all
vaccinations during the
induction phase and the first vaccination (boost) during the maintenance
phase.
Example 12: Pharmacodynamic Studies
The immunization strategy is a "prime-boost" approach, involving an initial
series of
closely spaced immunizations to induce an immune response followed by a period
of rest to
allow memory T-cells to be established. This will be followed by a booster
immunization, and
the T-cell response 4 weeks after this boost (16 weeks after the first
vaccination) is expected to
generate the strongest response and will be the primary immunological
endpoint. Immune
monitoring will be performed in a step-wise fashion as outlined below to
characterize the
intensity and quality of the elicited immune responses. Peripheral blood will
be collected and
PBMC will be frozen at two separate time points prior to the first vaccination
(baseline) and at
different time points thereafter as illustrated in Schema B and specified in
the study calendar.
Immune monitoring in a given patient will be performed after the entire set of
samples from the
induction phase and the maintenance phase, respectively, have been collected.
If sufficient
111

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
tumor tissue is available, a portion of the tumor will be used to develop
autologous melanoma
cell lines for use in cytotoxic T-cell assays.
Example 13: Screening ex vivo IFN-y ELISPOT
For each patient, a set of screening peptides will be synthesized. The
screening peptides
will be 15 amino acids in length (occasionally a 16mer or 17mer will be used),
overlapping by 11
amino acids and covering the entire length of each peptide or the entire
length of the neo0RF for
neo0RF-derived peptides. The entire set of patient-specific screening peptides
will be pooled
together at approximately equal concentration and a portion of each peptide
will also be stored
individually. Purity of the peptide pool will be ascertained by testing PBMC
from 5 healthy
donors with established low background in ex vivo IFN-y ELISPOTs. Initially.
PBMC obtained
at baseline and at week 16 (the primary immunological endpoint) will be
stimulated for 18 hours
with the complete pool of overlapping 15-mer peptides (11 amino acids overlap)
to examine the
global response to the peptide vaccine. Subsequent assays may utilize PBMC
collected at other
time points as indicated. If no response is identified at the primary
immunological endpoint
using the ex vivo IFN-y ELISPOT assay, PBMC will be stimulated with the
peptide pool for a
longer time period (up to 10 days) and re-analyzed.
Example 14: Deconvolution of epitopes in follow-up ex vivo IFN-y ELISPOT
assays.
Once an ex vivo IFN-y ELISPOT response elicited by an overlapping peptide pool
is
observed (defined as at least 55 spot forming units / 106 PBMC or increased at
least 3 times over
baseline), the particular immunogenic peptide eliciting this response will be
identified by de-
convoluting the peptide pool based into sub-pools based on the immunizing
peptides and
repeating the ex vivo IFN-y ELISPOT assays. For some responses, an attempt
will be made
to precisely characterize the stimulating epitope by utilizing overlapping 8-
10 mer
peptides derived from confirmed, stimulating peptides in IFN-y ELISPOT assays.
Additional
assays may be conducted on a case-by case basis for appropriate samples. For
example,
112

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
= The entire 15mer pool or sub-pools will be used as stimulating peptides
for
intracellular cytokine staining assays to identify and quantify antigen-
specific
CD4+, CD8+, central memory and effector memory populations
= Similarly, these pools will be used to evaluate the pattern of cytokines
secreted by
these cells to determine the TH1 vs TH2 phenotype
= Extracellular cytokine staining and flow cytometry of unstimulated cells
will be
used to quantify Treg and myeloid-derived suppressor cells (MDSC).
= If a melanoma cell line is successfully established from a responding
patient and
the activating epitope can be identified, T-cell cytotoxicity assays will be
conducted using the mutant and corresponding wild type peptide
= PBMC from the primary immunological endpoint will be evaluated for
"epitope
spreading" by using known melanoma tumor associated antigens as stimulants
and by using several additional identified mutated epitopes that were not
selected
to be among the immunogens
Immuno-histochemistry of tumor samples will be conducted to quantify CD4+,
CD8+, MDSC, and Treg infiltrating populations.
Example 15: Pipeline for the systematic identification of tumor neoantigens
Recent advances in sequencing technologies and peptide epitope predictions
were
leveraged to generate a two-step pipeline to systematically discover candidate
tumor-specific
HLA-bound neoantigens. As depicted in FIG. 10, this approach starts with DNA
sequencing of
tumors (e.g., by either whole-exome (WES) or whole-genome sequencing (WGS)) in
parallel
with matched normal DNA to comprehensively identify non-synonymous somatic
mutations (see
e.g., Lawrence et al. 2013; Cibulski et al. 2012). Next, candidate tumor
specific mutated
peptides generated by tumor mutations with the potential to bind personal
class I HLA proteins,
and hence be presented to CD8+ T cells, may be predicted using prediction
algorithms such as,
for example. NetMHCpan (see e.g., Lin 2008; Zhang 2011). Candidate peptide
antigens were
further evaluated based on experimental validation of their binding to HLA and
expression
cognate mRNAs in autologous leukemia cells.
This pipeline was applied to a large dataset of sequenced CLL samples (see
e.g.. Wang et
113

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
al. 2011). From 91 cases that were sequenced by either WES or WGS, a total of
1838 non-
synonymous mutations were discovered in protein-coding regions, corresponding
to a mean
somatic mutation rate of 0.72 ( 0.36 s.d.) per megabase (range, 0.08 to 2.70),
and a mean of 20
non-synonymous mutations per patient (range, 2 to 76) (see e.g., Wang et al.
2011). Three
general classes of mutations were identified that would be expected to
generate regions of amino
acid changes and hence potentially be recognized immunologically. The most
abundant class
included missense mutation that cause single amino acid (aa) changes,
representing 90% of
somatic mutations per CLL. Of 91 samples. 99% harbored missense mutations and
69% had
between 10-25 missense mutations (see e.g., FIG. 2A). The other two classes of
mutations,
frameshifts and splice-site mutations (mutations at exon-intron junctions)
have the potential to
generate longer stretches of novel amino acid sequences entirely specific to
the tumor (neo-open
reading frames, or neo0RFs), with a higher number of neoantigen peptides per
given alteration
(compared to missense mutations). However, consistent with data from other
cancer types,
neo0RF-generating mutations were approximately 10 fold less abundant than
missense
mutations in CLL (see e.g., FIGS. 2B-C). Given the prevalence of missense
mutations,
subsequent experimental studies was focused on the analysis of neoepitopes
generated by
missense mutations.
Example 16: Somatic missense mutations generate neopeptides predicted to bind
to
personal HLA class I alleles
T cell recognition of peptide epitopes by the T cell receptor (TCR) requires
the display of
peptides bound within the binding groove of HLA molecules on the surface of
antigen-
presenting cells. Recent comparative studies across the >30 available class I
prediction
algorithms have shown NetMHCpan to consistently perform with high sensitivity:
and
specificity across HLA alleles (see e.g., Zhang et al. 2011).
The NetMHCpan algorithm was tested against a set of 33 known mutated epitopes
that
were originally identified in the literature on the basis of their functional
activity (i.e., ability to
stimulate antitumor cytolytic T cell responses) or were characterized as
immunogenic minor
histocompatibility antigens to determine whether the algorithm would correctly
predict binding
for the 33 known mutated epitopes (see e.g., Tables 4 and 5). Tables 4 and 5
show HLA-peptide
114

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
binding affinities of known functionally derived immunogenic mutated epitopes
across human
cancers using NetMHCpan. Table 4 shows epitopes from missense mutations
(NSCLC: non-
small cell lung cancer; MEL: melanoma; CLL: chronic lymphocytic leukemia; RCC:
clear cell
renal carcinoma; BLD: bladder cancer; NR: not reported:). Yellow: IC50 < 150
nM, green: IC50
150-500 nM and grey: IC50 > 500 nM.
115

Table 4
0
t....)
=
¨
T cell
.6.=
---,
=-,
Clinical response HLA Mutated Wildtype W/MUT
tr,
Qe
Group Gene
Disease Reference OO
--4
Response Allele Observed Predicted Observed Predicted IC50
.6.
MUT> WT
epitope IC50 (nM) epitope
IC50 (nM)
ME-1 NSCLC ' Yes ' Yes A"02:01 - FLDEFMEGV 3
FLDEFMEAV 2 ' 0.7 ' (50) '
PLEKHM2 MEL Yes Yes A"01 :01 LTDDRLFTCY 3
LTDDRLFTCH 97 32 (36)
PRDX5 MEL NR Yes A"02:01 LLLDDLLVSI 5 LLLDDSLVSI 7
1.4 51)
MATN2 MEL Yes Yes A*11:01 KTLTSVFQK 5 ETLTSVFQK
20 4 (36)
P
DDX21 MEL Yes Yes A"68:01 EAFIQPITR 10
EASIQPITR 29 3 (52) 0
n,
0
0
RBAF MEL Yes Yes B"07:02 RP HVP ESAF 10
GPHVPESAF 68 7 (13) ..
.e.
GAS7 MEL Yes Yes A"02:01 SLADEAEVYL 12 SLADEAEVHL 39 3 (14) 0
(3,
1
SIRT2 MEL Yes Yes A"03:01 KIFSEVTLK 14
KIFSEVTPK 16 1.1 (13) 0
,a
1 EF2 NSCLC NR Yes A-6802 ETVSEQSNV 16 ETVSE
ESN V 27 2 (53)
GAPDH MEL ' Yes ' Yes - A"02:01 GIVEGLITTV '
21 GIVEGLMTTV ' 27 1.3 ' (14)
HSP 70 RCC NR Yes A"0201 SLFEGIDIYT 23
SLFEGIDFYT 7 0.3 (54)
ACTININ NSCLC Yes Yes A"02:01 FIASNGVKLV 29
FIASKGVKLV 44 2 (55)
CDK12 MEL Yes Yes A1101 CILGKLFTK 33 CI
LGELFTK 42 1.3 (36)
"d
KIAA1440 RCC Yes Yes A"01 :01 QTACEVLDY 33
QTTCEVLDY 78 2 (14) n
HAUS3 MEL Yes Yes A"02:01 ILNAMIAKI 34 I
LNAMITKI 36 1.1 (36) C4
t..)
=
PPP1R3B MEL Yes Yes A"01 :01 YTDFHCQYV 49
YTDFPCQYV 72 1.5 (36)
.6..
MUM-2 MEL Yes Yes ......õ. . . . . ... , .......õ,
..õ..õ.....õ .... . . . . ......,..
B*4402 SELF RSG L DSY
i:::::::::::::ff:FA::::::::::: S EL FRSRLDSY
:::::*i:i:ii:i, 1 (56) ta
2 KIAA 0205 BLD NR Yes 13"4403
AEPIDIQTW muom AEPINIQTW 0MiHi 1.1 (57) Cat
!A

GPNMB MEL Yes Yes A"03 01
TLDWLLQTPK i:i':i:i::i:Mi:i:i:iii:if: TLGWLLQTPK 179 0.6 (13)
CSNK1A1 MEL Yes Yes A'0201 GLFGDIYLAI 6 G S FG D
I YLAI M.11:.81. 210 (36)
C)
CLPP MEL Yes Yes A"0201 I LDKVLVH L 32 I
LD KVLV H P i:4.8.4Mi: 238 (58) C...)
MbMZ.
=
...,
CTNNB1 MEL Yes Yes A*2402 SYL DSG I HF 41
SYL D SG I HS E137.46::.:, 457 (59) .6.=
..,
tr,
SNRP MEL Yes Yes A"03 :01 KI LDAVVAQK 48
KI LDAVVAQE 0:.:14'6.'7 312 (13) Qe
---1
3 0S9 MEL N R Yes B*4403 KELEGILLL 60 KE LEG I
L L P S;ViOW,:::; 19 (60) .6.=
MYH2 MEL Yes Yes A"03 01 KINKN P KYK 141 E
I N KN P KYK M49.a. 35 (61)
FLGGN EVG KT
MART-2 MEL Yes Yes A*01:01 FL EG N
EVGKTY ;igi;i:OiMM iN4.04:.:...A 4 (62)
;M:H:ffil Y
NFYC NSCLC NR Yes B"5201 AQQ IT KT EV
:::3.1::4M: AQQ ITQT EV M:Vt' :::::::: 0.8 (63)
4 CDK4 MEL NR Yes A110201 ACDPHSGH FV M::.1i1.:1
ARDPH SG H FV :i::AW:::i: 2 (64)
0
... ..... , .
N,
0
os
p¨k Table 5 shows epitopes from minor histocompatibility antigens (MM:
multiple myeloma; HM: .,..
.,:..
hematological malignancy; B-ALL: B cell acute lymphocytic leukemia).
.
u,
,
Table 5
w
0
T cell
Clinical
response Mutated
WT/MUT
Group Gene Disease Response Allele
Reference
Observed Predicted Observed Predicted IC50
MUT> WT
epitope IC50 (nM) epitope
IC50 (nM)
1 ECGF-1 MM Yes Yes B"07:02 RP HAI RRP LAL 3
RPRAIRRPLAL 2 0.7 (65)
KIAA022
n
1 HM Yes NR A*02:01 VLHDDLLEA 17
VLRDDLLEA 140 8 (66)
3 (HA-1)
-r=7
C4
t..)
1 BCL2A1 HM N R Yes A"24:02 DYLQYVLQ I 22
DYLQCVLQ I 34 2 (67) =
.6..
1 BCL2A1 HM NB Yes A"24:02 KEFE D D II NW 36
KEFEDGIINW 27 0.8 (67) i
ta
ta
1 HB-1 B-ALL NB Yes B"44:03 EEKRGSLHVW 81 EEKRGSLYVW 67 1
(68) cc
!..11

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Among all tiled 9-mer and 10-mer possibilities, NetMHCpan identified all 33
functionally validated mutated epitopes as the best binding peptide among the
possible choices
for the given mutation. The median predicted binding affinity (IC50) to the
known reported
HLA restricting elements of each of the 33 mutated epitopes was 32 nM (range,
3-11, 192 nM).
By setting the predicted IC50 cut-offs to 150 and 500 nM, 82 and 91% of the
functionally
validated peptides, respectively, were captured (see e.g., Tables 4 and 5 and
FIG. 12A).
On the basis of its high degree of sensitivity and specificity. NetMHCpan was
then
applied to the 31 of 91 CLL cases for which HLA typing information was
available. By
.. convention, peptides with IC50 < 150 nM were considered as strong to
intermediate binders,
IC50 150-500 nM as weak binders, and IC50 > 500 nM as non-binders,
respectively (see e.g.,
Cai et al. 2012). For all 91 CLL cases, a median of 10 strong binding peptides
(range, 2-40) and
12 intermediate to weak binding peptides (range, 2-41) was found. In total, a
median of 22
(range, 6-81) peptides per case was predicted with IC50 < 500 nM (see e.g.,
FIG. 12B and Table
6). In particular, Table 6 shows that the numbers and affinity distributions
of peptides predicted
from 31 CLL cases with available HLA typing. Patients expressing the 8 most
common HLA -
A, -B alleles in the Caucasian population are marked in grey.
118

CA 02908434 2015-09-30
WO 2014/168874
PCT/1JS2014/033185
Table 6.
Pt a iiLA -A a1leies IELA -6 linczn-
irfp6n alWes # o1prodk:ted
fleopepti4ea
*tiit:01 1`0.2:01 *2C0,2 *15:111 '8:01 1S0-
tniq
10 .12
13
p.?
10.1 P-14::L12 s
174'14 8'61 672 :01 -Er.
P2a a!a!SE B.48:61 .10
==, a-18.1)1: 7
Pa; E6Mffiq 8,8'1:01 11 1s
pa? Esmi A'33:1:12; E'4.4::33 2
4
P ii0 an:ISZ1 26
10 18
A'23:01: -
P82 68 13 2E3
-N
A'28: 31: 2.4 2c:
0 10
A-11
Art1:3.1 , Ei.5`4462; 13
PSS. A >.'01
figl!E!1! A'28:,3' 13 1:1
A'31:61;
A*-2.0:=62; 7
B1-36:31: '61
14 18
2LD'. I03
119

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Example 17: More than half of predicted HLA-binding neopeptides showed direct
binding
to HLA proteins in vitro
As shown in Table 7, IC50 nM scores generated by HLA-peptide binding
predictions
were validated using a competitive MHC I allele binding assay and focused on
class I-A and ¨B
.. alleles. To this end, 112 mutated peptides (9 or 10-mer mutated peptides)
with predicted IC50
scores of less than 500 nM that were identified from 4 CLL cases (Pt 1-4) were
synthesized. The
experimental results correlated with the binding predictions. Experimental
binding (defined as
IC 50 < 500 NM) was confirmed in 76.5% and 36% of peptides predicted with IC50
of < 150
nM or 150-500 nM, respectively (see e.g., FIG. 12C). In total, ¨54.5% (61/112)
of predicted
peptides were experimentally validated as binders to personal HLA alleles.
Overall, the
predictions for 9-mer peptides were more sensitive than for 10-mer peptides,
as 60% vs 44.5% of
predicted peptides (IC50 <500 nM) could be experimentally validated,
respectively, as shown in
(FIG. 13).
120

Table 7. Predicted and experimental HLA-binding results of candidate
neoepitopes generated from 4 CLL cases.
Pt Gene Sequence Length HLA allele Candidate
neoepitopes 0
IC50 (nM)
,
7-1
,
Predicted
Experimental ..,
. . , .
QO
1 THOC6 ELWCRQPPYR 10 A*33:01 10
18 00
--.1
.1
1 THOC6 ELWCRQPPYR 10 A*68:12 59
5.1
1 CDC25A QSYCEPSSYR 10 A*68:12 23
1.5
1 ALMS1 TVPSSSFSHR 10 A*68:12 25
11
1 WHSC1L1 EVQASKHTK 9 A*68:12 33
58
1 CRYBA1 WVCYQYSGYR 10 A*33:01 44
972
1 CDC25A SYCEPSSYR 9 A*33:01 70
14
1 THNSL2 ATIESVQGAK 10 A*68:12 71
42 P
1 ALMS1 TPTVPSSSF 9 B*35:01 75
91 .
0
..
1 RALGAPB WIMVLVLPK 9 A*68:12 95
218 .
=.
r) 1 THOC6 ELWCRQPPY 9 B*35:01 112
13776
.
,
1 RALGAPB DWIMVLVLPK 10 A*33:01 117
37826 .
1 C6orf89 MPIEPGDIGC 10 B*35:01 132
131 0
1 STRAP LISACKDGKR 10 A*68:12 163
15845
1 CRYBA1 YQYSGYRGY 9 B*35:01 170
9851 , ,
. .
1 " WHSC1L1 ' LLNEVQASK 9 A*68:12 197
7440
1 RALGAPB DWIMVLVLPK 10 A*68:12 222
2956
1 STRAP ISACKDGKR 9 A*68:12 224
6671 -o
n
1 XPO1 KTVVNKLFK 9 A*68:12 253
25393
1 HMGN2 NSAENGDAK 9 A*68:12 258
141 u)
t..)
=
1 THOC6 LWCRQPPYR 9 A*33:01 297
915 .
.P
--
1 POLR2A VQKIFHINPR 10 A*33:01 308
17699 w
(.4
1 CDC25A QSYCEPSSYR 10 A*33:01 309
53 ot
Vi
.
1 ALMS1 SSSFSHREK 9 A*68:12 314
1496

1 CDC25A SYCEPSSYR 9 A*68:12 314
812
1 ALMS1 TVPSSSFSHR 10 A*33:01 335
237
1 THNSL2 TIESVQGAK 9 A*68:12 338
953 0
r.4
=
1 POLR2A MIWNVQKIF 9 B*35:01 393
541 7-1
,
1 CDC25A QSYCEPSSY 9 B*35:01 478
50000 ..
t..-,
QO
00
1 DSCAML1 SSIRSFVLQY 10
B*35:01 480 9195 --4
.1
, , .
.
2 NIN FLQEETLTQM 10 A*02:01 10.63
1.1
, , , .
.
2 FNDC3B VVMSWAPPV 9 A*02:01 4.21
6.4
2 SLC46A1 CS DSKLIGY 9
A*01:01 8.13 8.5
2 SYT15 EMLIKPKEL 9 B*08:01 414.37
8.9
2 F2R ILLMTVISI 9 A*02:01 41.91
11
2 ACSM2A SLMEHWALG 9 A*02:01 413.95
17
P
2 Cl 6orf57 LLRVHTEHV 9
B*08:01 443.97 28 2
2 ACSM2A SLMEHWALGA 10
A*02:01 5.67 40 ' 0
..
i7,7) 2 TBC1D9B KMTFLFPNL 9
A*02:01 t 63.7 62
2 SF3B1 G LVD EQQ EV 9 A*02:01 22.26
94 .
,
2 LRRC41 ALPD PILQS I 10 A*02:01 28.18
107 1'
2 LR RC41 GVWALPDP I 9
A*02:01 382.07 122
2 FNDC3B AVVMSWAPPV 10
A*02:01 98.15 123
2 F2R TSIDRFLAV 9 B*08:01 245.43
130
2 KIAA0467 G PSWG LS LM 9 B*07:02 179.31
137
2 Cl 6orf57 LLRVHTEHV 9
A*02:01 454.23 175
, , .
.
2 C22orf28 WVNCSSMTFL 10
A*02:01 302.94 274 -o
n
2 FNDC3B VMSWAPPVGL 10
A*02:01 37.77 378
;=-1-
u)
2 GDF2 ILYKDDMGV 9 A*02:01 13.74
567 t..)
=
2 FNDC3B NIQARAVVM 9 B*08:01 145.51
743 .P
-i-
2 C16orf57 HVRCKSGN KF 10
B*08:01 340.37 803 w
(.4
ot
2 LRRC41 LPDPILQSIL 10 B*07:02 243.46
855 Vi

2 F2R SI LLMTVTS I 10 A*02:01 301.24 929
2 ACSM2A LMEHWALGA 9 A*02:01
314.16 968
2 LRRC41 LPDPILQSI 9 B*07:02
471.62 1056 0
r.4
=
2 C16orf57 VLLRVHTEHV 10 A*02:01
23.04 1252 7-1
,
2 TBC1D9B FPNLKDRDFL 10 B*07:02
107.39 1423 .
t..-,
QO
00
2 SYT15 MLIKPKELV 9 A*02:01 162.61 1442
--.1
.1
, , . .
2 ACSM2A ILCSLMEHWA 10 A*02:01
424.59 1651
... ...
2 TBC1D9B FPNLKDRDF 9 B*07:02
280.32 1687
2 GDF2 SILYKDDMGV 10 A*02:01 140.39 1775
2 TP53 NTFRHRVVV 9 B*08:01 285.7 1789
2 SF3B1 EVRTISALAI 10 B*08:01 327.97 2322
2 GDF2 VPTKLSPIS I 10 B*07:02 132.77 3416
P
2 ELK3 LLLQDSECKA 10 A*02:01 437.05 5074
2
2 KIAA0467 SQPGPSWGL 9 A*02:01
128.72 6511 ' 0
..
2 RNF150 KPAVSSDSD I 10 B*07:02
228.47 8085 ..
3 ZNF182 ITHTGEKPY 9 B*15:01
205.26 92 .
,
3 ZNF182 ITHTGEKPYK 10 A*03:01
443.32 40 1'
3 7NF253 KFSNSNIYK 9 A*03:01
116.69 273
3 IREB2 LTRGTFANIK 10 A*01:01 343.52 739
3 TLK2 LTDFGLSKIM 10 A*03:01 164.9 1897
3 TLK2 LTDFGLSKI 10 A*01:01 227 10452
3 TLK2 KLTDFGLSK 9 A*03:01 26 41
, , ... ...
3 MYD88 SLSLGAHQK 9 A*03:01 122.42 30
-o
n
3 PATE2 FLKHKQSCAV 10 B*08:01 17 21
;=-1-
u)
3 PATE2 GVMTSCFLK 9 A*03:01 25 29
t..)
=
3 PATE2 FLKHKQSCA 9 B*08:01 19 51
.P
-i-
3 JTB GLLCAFTLK 9 A*03:01 12 62
(.4
(.4
ot
3 JTB HLCGLLCAF 9 B*15:01 117 125
Vi

3 0R13C5 LSIFKISSL 9 B*08:01 151
158
3 PATE2 VMTSCFLKHK 10 A*03:01
140 174
3 PATE2 MTSCFLKHK 9 A*03:01
147 218 0
r.4
=
3 0R13C5 KISSLEGRSK 10 A*03:01
185 257 71
--,
3 0R13C5 LSIFKISSL 9 B*15:01 152
368 ..,
QO
00
4 MAPK14 RPTFYROGL 9 B*07:02
6.7 76
.1
4 SCYL2 EVAGFVFDK 9 A*68:01
7.3 14
. .
4 SCYL2 EVAGFVFDKK 10 A*68:01
7.4 8.8
4 COL5A3 FTAGGEPCLY 10 A*01:01
14 153
4 MPDZ FSIVGGYGR 9 A*68:01 20
2.6
4 CUL1 YMKKAEAPL 9 B*08:01
36 34841
4 MUC2 APITTTTTV 9 B*07:02 53
13
P
4 KDM5D HSIPLRQSVK 10 A*68:01
55 45 2
4 TBC1D25 ISYLGRDRLR 10 A*68:01
106 556 2
..
4 NUP98 APGFNTTPA 9 B*07:02
107 13 ..
r--) 4 ZNF330 KAFFCDDHTR 10 A*68:01
137 102 .
,
-P.
.
4 MPDZ RPHGDLPIYV 10 B*07:02
155 1321 1'
4 TBC1D25 RLRQEVYLSL 10 B*08:01
165 1084
4 CUL1 YMKKAEAPLL 10 B*08:01
168 138
4 TBC1D25 RLRQEVYLSL 10 B*07:02
183 114
4 LANCL1 CLTKRSIAF 9 B*08:01 205
47
4 COL5A3 FTAGGEPCLY 10 A*68:01
230 11
4 SF381 EYVLNTTAR 9 A*68:01 301
651 -o
n
4 CNN1 DPKLGTAQPL 10 B*07:02
369 3974
u)
4 PPP2R2C QTHEPEFDY 9 A*01:01
435 26184 t..)
=
4 MUC2 AP ITTTTTVT 10 B*07:02 436
3731 .P
-i-
4 CUL1 EAPLLEEQR 9 A*68:01 454
36 w
(.4
ot
4 LANCL1 CLTKRSIAFL 10 B*08:01
467 640 Vi

4 NUP98 APGFNTTPAT 10 B*07:02 475 5744
4 MUC2 TTAPITTTT 9 A*68:01 479 118
4 CUL1 YMKKAEAPL 9 B*07:02 480 7927
4 LOXL2 IPGFKFDNL 9 B*07:02 487 809
An experimental binding assay for A*68:12 was not available. Because A*68:12
and A*68:01 have identical primary structures tr,
in the B and F main peptide binding pockets and have been predicted to have
similar binding specificity (Sidney and Sette, 2007),
experimental binding for peptides predicted to bind A*68:12 were assayed
against A*68:01.
c.)
JI
-o-
Co4

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Example 18: Neoantigens are expressed in CLL tumors
CTL responses against an epitope would only be useful if the gene encoding the
epitope
is expressed in the target cells. Of the 31 patient samples sequenced and
typed for EILA, 26 were
subjected to genome-wide expression profiling (see e.g., Brown et al, 2012).
The expression
level of 347 genes with mutations in CLL samples was classified as having
low/absent (lowest
quartile), medium (middle two quartiles), or high (highest quartile)
expression. As shown in
FIG. 12D, 80% of the 347 mutated genes (or 79% of the 180 mutations with
predicted HLA-
binding) were expressed at medium or high expression levels. A similar high
frequency of
expression was observed among the subset of 221 mutated genes (88.6%) with
predicted class I
binding epitopes.
RNA levels may be determined based on the number of reads per gene product,
and
ranked by quartiles. "H" - Top quartile; "M" ¨ Middle two quartiles; "L" ¨
Lowest quartile
(excluding genes with no reads; "-" ¨ no reads detectable. As the predicted
affinity decreases,
higher stringency may be applied to expression levels. Neo0RFs with, predicted
binders were
utilized even if there was no detectable mRNA molecules by RNA-Seq. There is
no data
currently available to assess what, if any, the minimum expression level
required in a tumor cell
would be for a neo0RF to be useful as a target for activated T-cells. Even the
level of
expression of "pioneer" translation of messages destined for nonsense mediated
decay may be
sufficient for target generation ((Chang YF, Imam IS, Wilkinson MF: The
nonsense-mediated
decay RNA surveillance pathway. Antal Rev Biochem 76:51-74, 2007). Therefore,
because of
the high value of neo0RFs as targets due to their novelty and exquisite tumor
specificity,
neoORFs may be utilized as immunogens even if expression at the RNA level is
low or
undetectable.
Example 19: T cells targeting candidate neoepitopes were detected in CLL
Patient 1
following HS CT
The post-allogeneic hematopoietic stem cell transplantation (HSCT) setting in
CLL was
analyzed to determine whether an immune response against the predicted mutated
peptides could
develop in patients. Reconstitution of T cells from a healthy donor following
HSCT can
overcome endogenous immune defects of the host, and also allow priming against
leukemia cells
126

CA 02908434 2015-09-30
WO 2014/168874 PCT/US2014/033185
in the host in vivo. Analysis focused on two patients who had both undergone
unrelated reduced
intensity conditioning allo-HSCT for advanced CLL and had achieved continuous
remission for
greater than 4 years following HSCT (see e.g., Table 8). Post-transplant T
cells were collected 7
years (Patient 1) and 4 years (Patient 2) from the time of transplant.
Table 8 shows the clinical characteristics of CLL Pts 1 and 2. Both patients
have
achieved ongoing continuous remission following HSCT of greater than 7 (Pt 1)
and 4 years (Pt
2). M: male; HSCT: hematopoietic stem cell transplantation; RIC: reduced
intensity
conditioning; Flu/Bu: Fludarabine/Busulfan; GvHD: graft vs host disease; URD:
unrelated
donor; Mis: missense; FS: frameshift.
127

Table 8.
Neoepitopes
ts.)
Allogeneic HSCT Number of Mutations (IC50 <500
nM)
Age/
Sex Stem Days to
Conditioning
HLA cell cGvHD GvHD Putative
regimen
Pt typing source Onset meds Total Mis FS drivers Predicted Experimental
A*33:01/
*68:12 I matinib/
B*35:01/ RIC URD Prednisone
1 *14:01 51/M Flu/Bu PBSC 448 33 25
8 XPO1 30 14
A*01:01/
*02:01
B*07:02/ RIC URD
TP53,
2 *08:01 72/M Fu/Bu PBSC 208 Imatinib
27 26 1 SF3B1 37 18
oo
0
JI
ci)

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
For Patient (Pt 1), 25 missense mutations were identified by WES. In total, 30
peptides
from 13 mutations were predicted to bind to personal HLA (13 peptides with
IC50 < 150; 17
peptides with IC50 150-500 nM). As shown in FIG. 14A, experimental validation
of peptide
predictions confirmed HLA binding for 14 peptides derived from 9 mutations.
All 30 predicted
HLA binding peptides were selected for T cell priming studies, and were
organized into 5 pools
of 6 peptides/pool (see e.g., Table 9). Peptides with similar predicted
binding scores were put
together within the same pool.
Table 9 provides a summary of peptides from Pt 1 missense mutations that were
included
in peptide pools for T cell stimulation studies. In Pt 1, all predicted
peptides with IC50 <500 nM
binding to HLA -A and -B alleles were used. 5 pools of mutated peptides with 6
peptides/pool
listed in decreasing order of predicted binding affinities to MHC class I
alleles. The
corresponding experimental HLA-peptide binding affinities, wildtype peptides
and their
predicted IC50 scores are included in the far right columns.
Table 9.
mUT peptide WT peptide
HLA Predicted Experimental
Predicted
Pool Gene Length allele Sequence IC50 (nM) IC50
(nM) Sequence IC50 (nM)
. . . .
THOC6 10 A*33:01 ELWCRQPPYR 10 18 ELWRRQPPYR 11
THOC6 10 A*68:12 ELWCRQPPYR 59 5.1 ELWRRQPPYR 61
CDC25A 10 A*68:12 QSYCEPSSYR 23 1.5 QSYCEPPSYR 37
1 ALMS1 10 A*68:12 TVPSSSFSHR 25 11
TVPSGSFSHR 35
WHSC1L 1 9 A*68:12 EVQASKHTK 33 58 EVQASEHTK
34
CRYBA1 10 A"33:01 WVCYQYSGYR 44 972 WVCYQYPGYR 50
CDC25A 9 A*33:01 SYCEPSSYR 70 14 SYCEPPSYR
61
THNSL2 10 A*68:12 ATI ESVQGAK 71 42
AAIESVQGAK 470
ALMS1 9 B*35:01 TPTVPSSSF 75 91 TPTVPSGSF
89
2 RALGAPB 9 A*68:12 WIMVLVLPK 95 218
WIMALVLPK 46
THOC6 9 B*35:01 ELWCRQPPY 112 13776 ELWRRQPPY
126
RALGAPB 10 A"33:01 DWIMVLVLPK 117
37826 DWI MALVLPK 171
129

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
C6orf89 10 B*35:01 MP IEPGDIGC 132 131
MPIEPGDIGY 3
STRAP 10 A"68:12 LISACKDGKR 163 15845
LI SACKDGKP 38499
CRYBA1 9 B35:01 YQYSGYRGY 170 9851 YQYPGYRGY
171
3 WHSC1L1 9 k68:12 LLNEVQASK 197 7440 LLNEVQASE 21454
RALGAPB 10 A"68:12 DWIMVLVLPK 222 2956
DWI MALVLPK 299
STRAP 9 A*68:12 ISACKDGKR 224 6671 ISACKDGKP 39393
XPO1 9 A*68:12 KTVVNKLFK 253 25393
KTVVNKLFE 18346
HMGN2 9 A68:12 NSAENGDAK 258 141 NPAENGDAK 3679
, , , , ..
THOC6 9 A33:01 LWCRQPPYR 297 915 LWRRQPPYR 222
4
POLR2A 10 A"33:01 VQKI F HI NPR 308 17699
AQKI FHI NPR 738
CDC25A 10 A"33:01 QSYCEPSSYR 309 53 QSYCEPPSYR 398
ALMS1 9 A*68:12 SSSFSHREK 314 1496
SGSFSHREK 3554
CDC25A 9 A68:12 SYCEPSSYR 314 812 SYCEPPSYR 597
ALMS1 10 A"33:01 TVPSSSFSHR 335 237
TVPSGSFSHR 378
THNSL2 9 A68:12 TIESVQGAK 338 953 AI ESVQGAK
3861
POLR2A 9 B35:01 MIWNVQKIF 393 541 MIWNAQKI F
294
CDC25A 9 B*35:01 QSYCEPSSY 478 50000
QSYCEPPSY 472
DSCAML I 10 Er35:01 SSIRSFVLQY 480 9195
SSIRGFVLQY 391
T cells were tested for neoantigen reactivity by expanding them using
autologous antigen
presenting cells (APCs) pulsed with candidate neoantigen peptide pools (once
per week X 4
weeks). As shown in FIG. 14B, reactivity in a IFN-7 ELISPOT assay was detected
against Pool
5 2, but not against an irrelevant peptide (Tax peptide). Deconvolution of
the pool revealed that
the mutated (mut) ALMS] and C6orf89 peptides within Pool 2 were immunogenic.
ALMS] plays
a role in ciliary function, cellular quiescence and intracellular transport,
and mutations in this
gene have been implicated in type II diabetes. C6orf89 encodes a protein that
interacts with
bombesin receptor subtype-3, which is involved in cell cycle progression and
wound repair of
bronchial epithelial cells. Both mutated sites were not in conserved regions
of the gene, and
were not within genes previously reported to be mutated in cancer. Both of the
target peptides
were among the subset of 14 predicted peptides that could be experimentally
confirmed to bind
130

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Pt l's HLA alleles. The experimental binding scores of mut and wildtype (wt)
ALMS] were 91
and 666 nM, respectively; and of mut- and wt-C60RF89, 131 and 1.7 nM,
respectively (see e.g.,
FIG. 14C and Table 9). Both mutated genes localized to poorly conserved
regions and did not
localize to previously reported mutation sites in cancers (see e.g., FIGS. 15-
16).
Example 20: CLL Patient 2 exhibited immunity against a mutated FNDC3B peptide
that is
naturally processed
In Patient 2, the ability personal neoantigens to contribute to memory T
responses in the setting
of long-lived remission was tested. From this individual, 26 non-synonymous
missense
mutations were identified. In total, 37 peptides from 16 mutations were
predicted to bind to
personal HLA alleles, of which 18 peptides from 12 mutations could be
experimentally validated
(15 with IC50 < 150; 3 with IC50 150-500 nM) (see e.g., FIG. 17A). In Pt 2,
all 18
experimentally validated HLA-binding peptides were studied. T cell
stimulations were
performed using 3 pools of 6 peptides/pool (see e.g., Table 10). Table 10
shows a summary of
peptides from Pt 2 missense mutations that were included in peptide pools for
T cell stimulation
studies. In Pt 2, all peptides that were experimentally confirmed to bind to
HLA -A and -B
alleles were used. 3 pools of peptides with 6 peptides/pool listed in
decreasing order of
experimental binding affinity of mutated peptides. The corresponding wildtype
peptides and their
predicted IC50 scores are included in the far right columns.
Table 10.
MUT peptide WT peptide
HLA Predicted Experimental Predicted
Pool Gene Length allele Sequence IC50 (nM) IC50
(nM) Sequence IC50 (nM)
NIN 10 A*02:01 FLQEETLTQM 10.63 1.1
FLQEERLTQM 45
FNDC3B 9 A*02:01 VVMSWAPPV 4.21 6.2
VVLSWAPPV 9
SLC46A1 9 A*01:01 CSDSKLIGY 8.13 8.5
CWDSKLIGY 1778
1
SYT15 9 B"080:1 EMLIKPKEL 414.37 8.9
EMLSKPKEL 785
F2R 9 A"02:01 I LLMTVISI 41.91 11
ILLMTVISI 53
ACSM2A 9 A"02:01 SLMEHWALG 413.95 17
SLMEPWALG 1313
2 C1601157 9 B*080:1 LLRVHTEHV 443.97 28 LLRVHTEQV 498.35
131

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
ACSM2A 10 A*02:01 SLMEHWALGA 567 40 SLMEPWALGA 9.8
TBC1D9B 9 A*02:01 KMTFLFPNL 63.7 62 KMTFLFANL
93
. . .
SF3B1 9 A*02:01 GLVDEQQEV 22.26 94
GLVDEQQKV 51
LRRC41 10 A*02:01 ALPDPILQSI 28.18 107 ALPGP
I LQSI 99
LRRC41 9 A*02:01 GVWALPDPI 382.07 122
GVWALPGPI 963
FNDC3B 10 A02:01 AVVMSWAPPV 98.15 123 AVVLSWAPPV 89
F2R 9 B*080:1 TSI DRFLAV 245.43 130 I SI
DRFLAV 252
. . .
KIAA0467 9 B*07:02 GPSWGLSLM 179.31 137
GPSRGLSLM 39
3
CI6or/57 9 A*02:01 LLRVHTEHV 454.23 175
LLRVHTEQV 433.02
-
C22or126 10 A*02:01 WVNCSSMTFL 302.94 274
WVNRSSMTFL ' 835
FNDC3B 10 A*02:01 VMSWAPPVGL 37.77 378 VLSWAPPVGL 48
Peptides with similar experimental binding scores were combined within the
same pool.
Responses were assessed after 2 rounds of weekly stimulations of T cells
against mutated peptide
pool-pulsed autologous APCs, and T cells were found to be reactive against
Pool 1, as shown in
FIG. 17B. Deconvolution of the pool revealed mut-FNDC3B to be the dominant
immunogenic
peptide among others within this pool (experimental IC50 of mut- and wt-FNDC3B
were 6.2 and
2.7 nM, respectively; see e.g., FIG. 17C). The function of FNDC3B in blood
malignancies is
unclear, although down-regulation of FNDC3B expression is known to upregulate
miR-143
expression, which has been shown to differentiate prostate cancer stem cells
and promote
prostate cancer metastasis. Similar to ALMS] and C6orf89, the mutation in
FNDC3B neither
localized to evolutionarily conserved regions nor was it previously reported
in other cancers (see
e.g., FIGS. 15 and 16).
T cell reactivity against mut-FNDC3B was polyfunctional (secreting GM-CSF, IFN-
y and
IL-2), and specific to the mut-FNDC3B peptide but not its wildtype
counterpart. Testing T cell
reactivity against different concentrations of mut- and wt-FNDC3B peptides
revealed a high
avidity and specificity of mut-FNDC3B reactive T cells. T cell reactivity was
abrogated by the
presence of class I blocking antibody (W6/32), indicating that T cell
reactivity was class I
restricted (see e.g., FIGS. 17D-E). Moreover, the mut-FNDC3B peptide appeared
to be a
132

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
naturally processed and presented peptide since T cell reactivity was detected
against HLA-A2-
expressing APCs that were transfected with a 300 basepair minigene
encompassing the region of
gene mutation but not the wildtype minigene, as shown in FIG. 17E, right
panel.
Using a mut-FNDC3B/A2 -specific tetramer, a discrete population of mut-FNDC3B-
reactive CD8+ T cells was detected within Pool 1-stimulated T cells (2.42% of
the population)
compared to control PBMCs from a healthy adult HLA-A2+ volunteer (0.38%), as
shown in
FIG. 17F. Gene expression analysis of FNDC3B in a large dataset of 182 CLL
cases (including
Pt 2) and 24 CD19+ B cells collected from normal volunteers revealed this gene
to be relatively
overexpressed in Patient 2 compared to other CLLs and normal B cells, as shown
in FIG. 17G.
Accordingly, it is clear that long-lived neoantigen- specific T cells could be
tracked in CLL
Patient 2.
To define the kinetics of mut-FNDC3B specific T cells in relationship to post-
HSCT
course, Pt 2 T cells isolated from different time points before and after HSCT
were stimulated
for 2 weeks and then tested for IFN-y reactivity on ELISPOT. The emergence of
mut-TNDC3B-
specific T cells coincided with molecular remission and was sustained over
time with continuous
remission. As shown in FIG. 18 (top and middle panel), mut-FNDC3B T cell
responses were not
detected before or up to 3 months following HSCT. Molecular remission was
first achieved 4
months following HSCT, and mut-FNDC3B-specific T cells were then first
detected 6 months
following HSCT. Antigen-specific reactivity subsequently waned (between 12 and
20 months
post-HSCT), but was again strongly detected at 32 months post-HSCT. Based on
molecular
analysis of the TCR of the mut-FNDC3B-specific T cells, V1311 was identified
as the
predominant CDR3 VP subfamily used by the reactive T cells, as shown in FIG.
19 and Table
11). Table 11 shows primers used for amplification of the TCR VP subfamily.
Table 11.
Amplicon size
Name Forward primer sequence (5'-3') (bp)
V131 GCACAACAGTTCCCTGACTTGCAC 346
133

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
V132 TCATCAACCATGCAAGCCTGACCT 349
v33 GTCTCTAGAGAGAAGAAGGAGCGC 346
VI34 ACATATGAGAGTGGATTTGTCATT 378
V65.1 ATACTTCAGTGAGACACAGAGAAAC 396
V135.2 TTCCCTAACTATAGCTCTGAGCTG 343
V136 AGGCCTGAGGGATCCGTCTC 340
V137 CCTGAATGCCCCAACAGCTCTC 347
V138 ATTTACTTTAACAACAACGTTCCG 404
VI39 CCTAAATCTCCAGACAAAGCTCAC 348
V610 CCACGGAGTCAG G GGACACAG CAC 313
V611 TCCAACCTGCAAAGCTTGAGGACT 312
V612 CATGGGCTGAGGCTGATC 417
V1313.1 CAAGGAGAAGTCCCCAAT 372
V1313.2 GGTGAGGGTACAACTGCC 390
V614 GTCTCTCGAAAAGAGAAGAGGAAT 349
V1315 AGTGTCTCTCGACAG G CACAGG CT 352
V616 AAAGAGTCTAAACAGGATGAGTCC 395
V617 GGAGATATAGCTGAAGGGTA 372
V618 GATGAGTCAGGAATGCCAAAGGAA 380
vi319 TCCTCTCACTGTGACATCGGCCCA 322
V620 AGCTCTGAGGTGCCCCAGAATCTC 370
134

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
VI322 AAGTGATCTTGCGCTGTGTCCCCA 490
V1323 AGGACCCCCAGTTCCTCATTTC 435
VI324 CCCAGTTTGGAAAGCCAGTGACCC 509
V1325 TCAACAGTCTCCAGAATAAGGACG 352
Name Reverse primer sequence (5'-3')
External 013 GACAGCGGAAGTGGTTGCGGGGT
Internal C13 FAM-CGGGCTGCTCCTTGAGGGGCTGCG
This molecular information was used to develop a clone-specific nested PCR
assay.
Applying this assay, it was observed that T cells with the same specificity
for mut-FNDC3B
were not detected in PBMCs (n=3) and CD8+ T cells of normal healthy volunteers
(see e.g.,
Table 12), but could be detected with similar kinetics as detection of IFN-y
secretion following
HSCT in the patient as shown in FIG. 18, bottom panel. Although relative
numbers of clone-
specific T cells declined over time, lower concentrations of peptide antigen
could stimulate T
cell reactivity at 32 months compared to 6 months post-HSCT, indicating the
emergence of
potentially more antigen-sensitive memory T cells over time (see e.g.. FIG.
18, inset).
Table 12 shows detection of mut-FNDC3B specific TCR VI311, using T cell
receptor-
specific primers in Pt 2. A real-time PCR assay was designed to detect the mut-
FNDC3B-
specific TCR VI311 clone. This clone was not detectable in healthy donor PBMCs
(n=3) or CD8
T cells, but clearly detectable in cDNA from mut-FNDC3B reactive T cells from
Pt 2 (at 6
months post-HSCT). The PCR products were normalized over 18S ribosomal RNA. -,
negative:
no amplification; +, positive: amplification detected; ++, double positive:
amplification detected
and amplification level is more than median level of all positive samples.
135

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Table 12.
Vfl11 Clone specific
cDNA PCR 18s ribosomal RNA
T cell clone ++
Healthy donor PBMCs
(n=3)
Healthy donor CD8 T
cells
Example 21: Large numbers of candidate neoantigens were predicted across
diverse
cancers
The overall somatic mutation rate of CLL is similar to other blood
malignancies, but low
in comparison to solid tumor malignancies (see e.g., FIG. 20A). To examine how
tumor type
and mutation rate impacts the abundance and quality of candidate neoantigens,
the pipeline was
applied to publicly available WES data from 13 malignancies ¨ including high
(melanoma
(MEL)), lung squamous (LUSC) and adeno (LUAD) carcinoma, head and neck cancer
(HNC).
bladder cancer, colon and rectum adenocarcinoma, medium (glioblastoma (GBM),
ovarian, clear
cell renal carcinoma (clear cell RCC), and breast cancer) and low (CLL and
acute myeloid
leukemia (AML) cancers. To perform this analysis, a recently described
algorithm that enables
inference of HLA typing from the WES data was also implemented (Liu et al.
2013).
The overall mutation rate in these solid malignancies was an order of
magnitude higher
than for CLL and was associated with an increased median number of missense
mutations. For
example, melanoma displayed a median of 300 (range, 34-4276) missense
mutations per case,
while RCC had 41 (range, 10-101), respectively. Frameshift and splice-site
mutations in RCC
and melanoma were increased by only 2-3 fold in frequency as compared to CLL
and summed
neo0RF length per sample were increased only moderately (by 5-13 fold).
Overall, the median
136

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
number of predicted neopeptides with IC50 < 500 nM generated from missense and
frameshift
events per sample was proportional to the mutation rate; this was
approximately 20- and 4-fold
higher for melanoma (488; range, 18-5811) and RCC (80; range. 6-407)),
respectively, compared
to CLL (24; range 2-124). With a more stringent threshold of IC50 < 150 nM,
the corresponding
numbers of predicted neopeptides were 212, 35 and 10 for melanoma. RCC and
CLL,
respectively, as shown in FIG. 20B and Table 13).
Table 13 shows the distribution of mutation classes, summed neo0RF sizes and
number
of predicted binding peptides across 13 cancers. MEL:melanoma, LUSC: lung
squamous cell
carcinoma, LUAD: lung adenocarcinoma, BLCA: bladder, HNSC: head and neck
cancer,
COAD: colon adenocarcinoma, READ: renal adenocarcinoma, GBM: glioblastoma, OV:
ovarian, RCC: clear cell renal carcinoma, BRCA: breast, CLL: chronic
lymphocytic leukemia,
AML: acute myeloid leukemia. *-predicted number of peptides based on missense
and
frame shift mutations.
137

Table 13.
0
Cancer # of mutations/sample Summed
# of predicted peptides median
type median (range) NeoORF
(range)* =
7-1
Missense Frame Splice site
length/Sample IC50 < 150 (W) IC50 150-500 ,
r..-,
shift
(nM) ao
00
MEL 300 (34- 4276) 2(0-16) 4(0-101)
48(0-425) 212 (10-2566) 488 (18-5811) .-.4
.1
LUSC 212 (0-2397) 3 (0-28) 5 (0-37)
86.5 (0-975) 149.5 (0-1320) -- 351.5 (0-2946)
LUAD 172.5 (0- 7(0-61) 5(0-127)
173.5 (0-2137) -- 122 (0-6999) -- 269.5 (1-
8971)
16360)
BLCA 161.5 28- 6(0-22) 4(0-22) 152 (0-
780) 9719-1073) -- 232.5 (59-
1194)
2337) P
HNSC 95(2-1400) 5(0-106) 2(0-29)
124.5 (0-2585) 66.5 (2-1139) 159.5 (3-2916) .
0
..
COAD _ 93 (32- 5902) 4(1-182)
0(0-96) 121 (9-4794) -- 68(15-2155) -- 172 (40-5199)
..
c...)
.
oo
.
Q.,
, READ 72.5 (37- 2(0-31) 0(0-2) 51(0-929)
52(14-1215) 114(38-2750) .
1837)
.
GBM 47(0- 169) 2(0-16) 1(0-5)
47(0-539) -- 39(0-166) -- 90(0-332)
OV 42(9-149) 1(0-7) 1(0-6)
7.5 (0-328) -- 30(3-181) -- 70(13-420)
RCC 41(10-101) 6 (0-22) 1(0-8)
143 (0-813) -- 35 (2-223) -- 80 (6-407)
BRCA 25(1-300) 2(0-54) 1(0-8)
37(0-1415) 21(0-346) 47(0-781) -o
n
CLL 16 (0-75) 1 (0-9) 1 (0-6)
11(0-427) -- 10 (0-50) -- 24 (2-124)
u)
t..)
=
AML 7(0-20) 1(0-2) 0(0-3) 6(0-160) 4(0-19)
8(0-41) .
.P
-i-
(.4
(44
* Refers only to predicted epitopes arising from missense mutations.
.
Ot
Vi

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Example 22: Clinical strategies for addressing clonal mutations
"Clonal" mutations are those that are found in all cancer cells within a
tumor, while
"subclonal" mutations are those that statistically are not in all cancer cells
and therefore are
derived from a sub population within the tumor.
According to the techniques herein, bioinformatic analysis may be used to
estimate
clonality of mutations. For example, the ABSOLUTE algorithm (Carter et al,
2012, Landau et
al, 2013) may be used to estimate tumor purity, ploidy, absolute copy numbers
and clonality of
mutations. Probability density distributions of allelic fractions of each
mutation may be
generated followed by conversion to cancer cell fractions (CCFs) of the
mutations. Mutations
may be classified as clonal or subclonal based on whether the posterior
probability of their CCF
exceeds 0.95 is greater or lesser than 0.5 respectively.
It is contemplated within the scope of the disclosure that a neoantigen
vaccine may
include peptides to clonal, sub-clonal or both types of mutations. The
decision may depend on
the disease stage of the patient and the tumor sample(s) sequenced. For an
initial clinical study
in the adjuvant setting, it may not be necessary to distinguish between the
two mutations types
during peptide selection, however, one of skill in the art will appreciate
that such information
may be useful in guiding future studies for a number of reasons.
First, subject tumor cells may be genetically heterogeneous. Multiple studies
have been
published in which tumors representing different stages of disease progression
have been
evaluated for heterogeneity. These include examining the evolution from a pre-
malignant
disease (Myelodysplastic syndrome) to leukemia (secondary acute myelogenous
leukemia
[AMU (Walter et al 2012), relapse following therapy-induced remission of
AML(Ding et al
2012), evolution from primary to metastatic breast cancer and medulloblastomas
(Ding et al
139

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
2012; Wu et al Nature 2012), and evolution from primary to highly metastatic
pancreatic and
renal cancers (Yachida et al 2012; Gerlinger et al 2012). Most studies
utilized genome or exome
sequencing but one study also evaluated copy number variations and CpG
methylation pattern
variations. These studies have shown that genetic events are acquired during
cancer cell growth
which alter the profile of mutations. Many, and usually most (40 % - 90%), of
the earliest
detectable mutations (-founder mutations") persist in all evolved variants but
new mutations
unique to evolved clones do arise and these may be distinct between different
evolved clones.
These changes can be driven by host/cancer cell "environmental" pressures
and/or therapeutic
intervention and thus more highly metastatic disease or prior therapeutic
intervention generally
lead to more significant heterogeneity.
Second, it is contemplated that a single tumor for each patient may be
initially sequenced,
which may provide a snapshot of the profile of genetic variation for that
particular point in time.
The sequenced tumor may be derived from a clinically evident lymph node, in
transit/satellite
metastasis, or resectable visceral metastasis. None of the initially tested
patients will have
disease that has clinically progressed to multiple sites; however, it is
contemplated that the
techniques described herein in will be broadly applicable to patients have
cancer that has
progressed to multiple sites. Within this tumor cell population, -clonal
mutations" may be
comprised of both founder mutations and any novel mutations present in the
cell that seeded the
resected tumor and sub-clonal mutations represent those that evolved during
growth of the
resected tumor.
Third, the clinically important tumor cells for the vaccine induced T-cells to
target are
frequently not the resected tumor cells but rather other currently
undetectable tumor cells within
a given patient These cells may have spread directly from the primary tumor or
from the
140

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
resected tumor, may have derived from a dominant or sub-dominant population
within the
seeding tumor and may have genetically evolved further at the surgically
resected site. These
events are currently unpredictable.
Thus, for the surgically resected adjuvant setting, there is no a priori way
to decide
.. whether mutations found in the resected tumor that are clonal or subclonal
represent the optimal
choice for targeting other non-resected cancer cells. For example, mutations
that are subclonal
within the resected tumor may be clonal at other sites if those other sites
were seeded from a
subpopulation of cells containing the sub-clonal mutation within the resected
tumor.
In other disease settings however, such as settings in which patients carry
multiple and
metastatic lesions, sequencing of more than one lesion (or parts of lesion) or
lesions from
different time points may provide more information relative to effective
peptide selection.
Clonal mutations may typically be prioritized in the design of neo-antigen
epitopes for the
vaccine. In some instances, especially as the tumor evolves and sequencing
details from
metastatic lesions are evaluated for an individual patient, certain subclonal
mutations may be
prioritized for consideration as part of peptide selection.
Example 23: Personalized cancer vaccines stimulate immunity against tumor
neoantigens
The above-described detailed integration of comprehensive bioinformatics with
functional data in CLL and other cancers provides several novel biological
insights. First,
although CLL is a relatively low mutation rate cancer, it was nonetheless
possible to identify
epitopes generated by somatic mutations that elicited long-term T cell
responses. Whole-exome
sequencing data from 31 CLL samples revealed that per case, a median of 22
peptides (range, 6-
81) were predicted to bind to personal HLA-A and -B alleles with IC50 < 500nM
originating
from a median of 16 (range, 2-75) missense mutations. Approximately 75% and
half (54.5%) of
141

CA 02908434 2015-09-30
WO 2014/168874 PCT/1JS2014/033185
predicted peptides with IC50 < 150 nM and 500 nM, respectively, were
experimentally validated
to bind to the patient's HLA alleles. RNA expression analysis showed that
nearly 90% of the
cognate genes corresponding to the predicted mutated peptides were confirmed
to be expressed
in CLL cells and expression of a transcript from the mutated allele was
detected in each of the
three (data not shown) examples tested. Only a fraction of all neoepitopes had
generated a
spontaneous T-cell response although this response was still detectable years
after transplant;
¨6% (3/48) of all predicted and tested mutated peptides or 9% (3/32) of
experimentally validated
and tested mutated peptides stimulated IFN-7 secretion responses from patient
T cells. This rate
of neo-epitope discovery in CLL, a low mutation rate tumor, is remarkably
similar to the rates
recently reported in melanoma (4.5%, or 11/247 peptides; Robbins PF, Lu YC, El-
Gamil M, et
al: Mining exomic sequencing data to identify mutated antigens recognized by
adoptively
transferred tumor-reactive T cells. Nat Med, 2013), a high mutation rate
cancer. Hence,
functional neoepitopes can be systematically discovered across the broad range
of cancers
including low mutation rate tumors.
A second key finding is that T cell responses against CLL neoepitopes were
long-lived
(on the order of several years), associated with continuous disease remission
and were generated
during in vitro stimulation in a timeframe consistent with memory T cell
responses. These
studies add to the growing literature that responses against tumor neoantigens
contribute to
efficacious immune responses. Thus, although approximately 5% of predicted
peptides generated
from missense mutations yielded detectable T cell responses, the kinetics of
the response suggest
a possible role in ongoing anti-leukemia surveillance functions. The
functional impact of
neoantigen-directed T-cell responses is supported by a recent study from
Castle et al. (Castle JC,
Kreiter S, Diekmann J. et al: Exploiting the mutanome for tumor vaccination.
Cancer Res
142

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
72:1081-1091, 2012) who identified candidate neoepitopes by WES of B16 murine
melanoma
and prediction of peptide-HLA allele binders. A subset of these predicted
epitopes not only
elicited immune responses that were specific to the mutated peptide and not
the wildtype
counterpart, but could also control the disease both therapeutically and
prophylactically. While it
was difficult to directly compare the relative contributions of tumor
neoantigens versus other
types of CLL antigens such as overexpressed or shared native antigens (in
contrast to melanoma,
CLL tumor antigens are not well characterized) or to the GvL response, prior
characterization of
antigen-specific T cell responses from a melanoma patient with prolonged
survival suggest that
anti-neoantigen immunity is more prolonged and sustained over time than that
against shared
overexpressed tumor antigens.
Third, these results highlight the concept that targeting tumor-specific
"trunk" mutations
can be impactful from the immunologic standpoint. All three of the immunogenic
neoantigens
(mutated FND3CB, ALMS/, C6(489) in the two patients appeared to be passenger
mutations,
not directly contributory to the oncogenic process, and were clonal, affecting
the bulk of the
cancer mass. Several features of these immunogenic mutations suggest them to
be passenger
mutations: lack of sequence conservation around the mutation and lack of
previously reported
mutations in other cancers at the observed sites. Because clonal evolution is
a fundamental
feature of cancer, it has been posited that immunologic targeting of cancer
drivers would have
the advantage of minimal antigenic drift, given their essentiality in tumor
function that would
require them to be maintained in the face of selective pressure. Although such
an advantage may
be possible, it is apparently not a requirement. Additionally, driver
mutations may not
necessarily generate immunogenic peptides. For example. the TP53-S83R mutation
in Patient 2
did not generate a predicted epitope of < 500 nM against any of its class I
HLA-A or -B alleles.
143

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Finally, analysis of the binding characteristics of the neoantigen data from
the literature
(Table 4) as well as the candidate neoepitopes from the data in CLL revealed
conceptual insights
into the types of point mutations most likely to effectively create a T cell
response. It was found
that a consistent feature of immunogenic neoepitopes was a predicted binding
affinity < 500 nM
(3 of 3 of immunogenic CLL peptides and 30 of 33 [91%] of the historical
functional
neoepitopes) and the majority of these (92%) displayed predicted affinities <
150 nM.
Unexpectedly however, in most cases (3 of 3 immunogenic CLL peptides and 27 of
33 [82%]
historical functional epitopes), the corresponding wild type epitopes were
also predicted to bind
with comparable strong/intermediate (< 150 nM, Group 1 in Table 4) or weak
(150 ¨ 500 nM,
Group 2 in Table 4) affinity. The data support the idea that two types of
mutations are
commonly observed among naturally occurring T-cell responses to neoantigens:
(1) mutations at
positions that lead to substantially better binding to the MHC allele (mutated
ALMS] as well as 6
of 33 (18%) of the historical functionally-identified neoepitopes ['Group 3',
Table 4]),
presumably due to improved interaction with MHC. or (2) mutations at positions
that do not
significantly interact with MHC but instead presumably alter the T cell
receptor binding ((2 of 3
CLL epitopes [FNDC3B and C6or189] and 24 of 33 (73%) naturally immunogenic
neoepitopes
['Group and 'Group 2', Table 4]). The distinction between these two types of
mutations fits
with the concept that the peptide can be considered as a "key', which must fit
both the MHC and
the TCR "locks" in order to stimulate cytolysis, allowing mutations to
independently vary MHC
or TCR binding. Excepting the contribution of minor histocompatiblility
antigens to graft-vs-
host disease, there are no reports of auto-immune sequelae linked to
neoantigens in these
patients, even in those patients where a reaction occurs to a mutated peptide
and the cognate
native peptide is predicted to be a tight binder. This result is consistent
with the idea that MHC-
144

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
binding native peptides are normally involved in the negative selection
process in which T cells
bearing TCRs reactive to these native peptides are thymically deleted or
rendered anergic, and
yet the T cell repertoire can accommodate the development of a specific immune
response to a
neoeptiope peptide due to an altered presentation of the mutated peptide to
the T cell receptor. It
.. is clear that each individual tumor in a patient may harbor a broad
spectrum of both shared and
personal genetic alterations that may continue to evolve in response to the
environment, and that
this progression may often lead to resistance to therapy. Given the uniqueness
and plasticity of
tumors, an optimal therapy may need to be customized based on the exact
mutations present in
each tumor, and may need to target multiple nodes to avoid resistance. The
vast repertoire of
human CTLs has the potential to create such a therapy that targets multiple,
personalized tumor
antigens. As discussed above, the present disclosure shows that it is possible
to systematically
identify CTL target antigens harboring tumor-specific mutations by using
massively parallel
sequencing in combination with algorithms that effectively predict HLA-binding
peptides.
Advantageously, the present disclosure allows tumor neoantigens in a variety
of low and high
.. mutation rate cancers to be predicted, and experimentally identifies long-
lived CTLs that target
leukemia neoantigens in CLL patients. The present disclosure supports the
existence of
protective immunity targeting tumor neoantigens, and provides a method for
selecting
neoantigens for personalized tumor vaccines.
As discussed in detail above, the techniques described herein were applied to
a unique
.. group of CLL patients who developed clinically evident durable remission
associated with anti-
tumor immune responses following allogeneic-HSCT. These graft-versus-leukemia
responses
have typically been attributed to allo-reactive immune responses targeting
hematopoietic cells.
However, the above described results indicate that the GvL response is also
associated with
145

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
CTLs that recognize personal leukemia neoantigens. These results are
consistent with data
indicating that the existence of GvL-associated CTLs with specificity for
tumor, rather than alio-
antigens. It has been postulated that neoantigen-reactive CTLs are important
in cancer
surveillance because the study of a long-term melanoma survivor found that
CTLs targeting
neoantigens are significantly more abundant and sustained than those against
non-mutated
overexpressed tumor antigens (Lennerz V, Fatho M, Gentilini C, et al: The
response of
autologous T cells to a human melanoma is dominated by mutated neoantigens.
Proc Nati Acad
Sci U S A 102:16013-8, 2005). The data presented above is consistent with this
melanoma study
because neoantigen-specific T cell responses in CLL patients were found to be
long-lived (on the
.. order of several years) memory T cells (based on their rapid stimulation
kinetics in vitro) and
associated with continuous disease remission. Accordingly, neoantigen-reactive
CTLs likely
play an active role in controlling leukemia in transplanted CLL patients.
More generally, the abundance of neoantigens across many tumors was estimated
and
found to be ¨1.5 HLA-binding peptides with IC50<500nM per point mutation and ¨
4 binding
peptides per frameshift mutation. As expected, the rate of predicted HLA
binding peptides
mirrored the somatic mutation rate per tumor type (see e.g., FIG. 20). Two
approaches were used
to study the relationship between predicted binding affinity and immunogenic
neoantigens that
induce CTLs. The above-described techniques were applied to published
immunogenic tumor
neoantigens (i.e. in which reactive CTLs were observed in patients)
demonstrated that the vast
majority (91%) of functional neoantigens are predicted to bind HLA with
IC50<500nM (with
¨70% of wild type counterpart epitopes predicted to bind at a similar
affinity) (see e.g., Table 4).
This test used a gold standard set of neoantigens confirmed that the
techniques described herein
correctly classify true positives. A prospective prediction of neoepitopes
followed by functional
146

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
validation showed that 6% (3/48) of predicted epitopes were associated with
neoantigen-specific
T cell responses in patients -- comparable to the rate of 4.8% found recently
for melanoma. The
low proportion does not necessarily imply low prediction accuracy for the
algorithm. Rather, the
number of true neoantigens is greatly underestimated because: (i) allo-HSCT is
a general cellular
therapy likely to induce only a small number of neoantigen-specific T cell
memory clones; and
(ii) standard T cell expansion methods are not sensitive enough to detect
naïve T cells that
represent a much larger part of the repertoire but with much lower precursor
frequencies.
Although the frequency of CTLs that target neo0RFs has yet to be measured, it
is specifically
contemplated within the scope of the invention that this class of neoantigens
may be an excellent
candidate neoepitope because it is likely to be more specific (for lack of a
wild type counterpart)
and immunogenic (as a result of bypassing thymic tolerance).
With the ongoing development of highly powerful vaccination reagents, the
present
disclosure provides techniques that make it feasible to generate personalized
cancer vaccines that
effectively stimulate immunity against tumor neoantigens.
MATERIALS AND METHODS
Patient samples: Heparinized blood was obtained from patients enrolled on
clinical
research protocols at the Dana-Farber Cancer Institute (DFCI). All clinical
protocols were
approved by the DFCI Human Subjects Protection Committee. Peripheral blood
mononuclear
cells (PBMCs) from patient samples were isolated by Ficoll/Hypaque density-
gradient
centrifugation, cryopreserved with 10% DMSO, and stored in vapor-phase liquid
nitrogen until
the time of analysis. For a subset of patients, HLA typing was performed by
either molecular or
serological typing (Tissue Typing Laboratory, Brigham and Women's Hospital,
Boston, MA).
147

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Whole exome capture sequencing data for CLL and other cancers: The list for
melanoma was obtained from dbGaP database (phs000452.vl.p1) and for the 11
other cancers,
through TCGA (available through the Sage Bionetworks' Synapse resource (on the
worldwide
web at (www)synapse.org/#!Synapse:syn1729383)). The HLA-A, HLA-B and HLA-C
loci in
2488 samples across these 13 tumor types were sequenced using a two-stage
likelihood based
approach, and this data is summarized in Table 14. Briefly, a dedicated
sequence library
consisting of all known HLA alleles (6597 unique entries), based on the IMGT
database, was
constructed. From this resource, a secondary library of 38-mers was generated,
and putative
reads emanating from the HLA locus were extracted from total sequence reads
based on perfect
matches against it. The extracted reads were then aligned to the IMGT-based
HLA sequence
library using the Novoalign software (on the worldwide web at
(www)novocraft.com), and HLA
alleles were inferred through a two-stage likelihood calculation. In the first
stage, population-
based frequencies were used as priors for each allele and the posterior
likelihoods were
calculated based on quality and insert size distributions of aligned reads.
Alleles with the highest
likelihoods for each of HLA-A, B and C genes were identified as the first set
of alleles. A
heuristic weighting strategy of the computed likelihoods in conjunction with
the first set of
winners were then used to identify the second set of alleles.
Table 14 shows TCGA patient IDs for neoantigen load estimates across cancers.
LUSC
(lung squamous carcinoma), LUAD (lung adeno carcinoma), BLCA (bladder), HNSC
(head and
neck), COAD (colon) and READ (rectum), GBM (glioblastoma), OV (ovarian), RCC
(clear cell
renal carcinoma), AML (acute myeloid leukemia) and BRCA (breast),
148

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
Table 14
TCGA Barcodes Disease IJUID
TCGA-BL-A0C8-01A-11D-A10S-08 BLCA 134b0a5e-a0ba-444d-bc4b-bdceb02d5b04
TCGA-BL-A13I-01A-11D-A13W-08 BLCA aa490522-7bb9-4f82-8f19-eaf631719bfe
TCGA-BL-A13J-01A-11D-A 10S-08 BLCA 0c7aca3f-e006-4de3-afc2-20b41727d4fd
TCGA-BL-A3JM-01A-12D-A21A-08 BLCA b181ba68450f-4faf-b7b5-356e119b5f04
TCGA-BT-A0S7-01A-11D-AIDS-08 BLCA b2e5d244-94c1-4dbf-8d33-34b595903310
TCGA-B T-AOYX-01A-11D-A 10S-08 BLCA d6 1 ccd8c-b798-46e0-aeed-
f95b4f3b a4ff
1CGA-BT-A20J-01A-11D-A14W-08 BLCA 1d3c0ff9-d149-4d21-8955-511,849fc5462
TCGA-BT-A20N-01A-11D-A14W-08 BLCA 341bbffe-7587-4adO-b3b4-68e64080e216
TCGA-BT-A200-01A-21D-A14W-08 BLCA 7df63263-de4e-4ed8-804f9e8fee3be2d5
TCGA-BT-A20P-01A-11D-A14W-08 BLCA e6c78a98445b-482b-a551-4fIlb8c1ff8b
TCGA-BT-A20Q-01A-11D-A14W-08 BLCA 8c619cbc-9e91-4716-9711-5236e55d8f46
TCGA-BT-A20R-01A-12D-A160-08 BLCA e9bbbfc3-0beb-4f91-92a1-081bff7c4a07
TCGA-BT-A20T-01A-11D-A14W-08 BLCA 301d6ce3-4099-4c1d-8e50-c04b7ce91450
TCGA-BT-A20U-01A-11D-A14W-08 BLCA 4576527b-b288-4f50-a9ea-5d5dede22561
TCGA-BT-A20V-01A-11D-A14W-08 BLCA 973d0577-8ca4-44a1-817f-ld3c lbada151
1CGA-BT-A20W-01A-21D-A14W-08 BLCA 85ccdf9b-1787-4701-822f-ae0fce5b41c5
TCGA-BT-A20X-01A-11D-A160-08 BLCA 9b4586ee-4091-484f-8be8-5a5196fe7b6f
TCGA-BT-A2T,13-01A-11D-,A18F-08 BI,CA e7aea 1 86-fl 3b-43b1-8693-
f90f51e005dd
TCGA-BT-A2LD-01A-12D-A20D-08 BLCA cc95719c-7fcc-4ed7-837e-1840c0a6bc27
TCGA-BT-A3PH-01A-11D-A21Z-08 BLCA cda1a403-16b6-487c-a82a-c377d1d0f89d
TCGA-BT-A3PJ-01A-21D-A21Z-08 BLCA b73523d7-f5a5-4140-8537-4df4d1ecf465
TCGA-BT-A3PK-01A-21D-A21Z-08 BLCA 4ad38e8e-e63e-41d9-9216-617be7fa 1
c175
TCGA-C4-A0EZ-01A-21D-A1 0S-08 BLCA b01a7081-8e05-4728-a517-52156cdfe7ed
TCGA-C4-A0F0-01A-12D-AIOS-08 BLCA 612fd956-9a41-4201-9d74-6ab50f6ae987
TCGA-C4-A0F1-01A-11D-A10S-08 BLCA 9377460a-8497-4168-b2c2-5f50cteda1fe
TCGA-C4-A0F6-01A-11D-A10S-08 BLCA 608f8c75-40e4-44f2-bdde-5f07aa6b4bee
TCGA-C4-A0F7-01A-11D-A10S-08 BT,CA f389176f-d8f3-45c2-aae4-7378a3d6fc7f
TCGA-CF-AHIR-01A-11D-Al 3W-08 BLCA 69acf4f1-063f-453d-b148-681518c0bc39
TCGA-CF-A1HS-01A-11D-A13W-08 BLCA b36e672b-c5d8-4481-bbb3-7be805215212
TCGA-CF-A27C-01A-11D-A160-08 BLCA acc629cb-ad03-4cec-9621-922e4932e13e
TCGA-CF-A3MF-01A-12D-A21A-08 BLCA c66c92d5-df65-46e6-861d-d8a98808e6a3
TCGA-CF-A3MG-01A-11D-A20D-08 BLCA 4c89ce08-ed24-4179-8884-4706660b7da8
TCGA-CF-A3MH-01A-11D-A20D-08 BLCA 8867b16f-cd05-41e9-b3ca-4c72alebe070
TCGA-CF-A3MI-01A-11D-A20D-08 BLCA Oafabd62-8454-41b4-9b02-386681589688
TCGA-CU-AOYN-01A-21D-A10S-08 BLCA 803ab221-b813-4bcc-95a9-1f686d172d3c
TCGA-CU-A0Y0-01A-11D-A1 0S-08 BLCA e8027819-2059-4e98-92b2-3e9868fc5818
1CGA-CU-A0YR-01A-12D-A 10S-08 BLCA 31382822-3792-47bc-99e8-8a 1 eel
e4e5813
149

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-CU-A3KJ-01A-11D-A21A-08 BLCA e22c6a44-4f8e-44eb-8ca8-dff0f2fc5575
TCGA-DK-A1A3-01A-11D-Al 3W-08 BLCA 2322f7cd-7d55-4a9f-b7f3-da3068089383
TCGA-DK-A1A5-01A-11D-A13W-08 BLCA 448fe471-3f4e-4dc8-a4e0-6f147dc93abe
TCGA-DK-A1A6-01A-11D-Al 3W-08 BLCA df8a913c-5160-4fc5-950d-7c890e24e820
TCGA-DK-A1A7-01A-11D-A13W-08 BLCA 91f458e6-64b7-454d-a542-bOaa236381118
TCGA-DK-A 1 AA-01A-11D-A13W-08 BLCA 804ffa2e-158b-447d-945c-707684134c87
TCGA-DK-AlAB-01A-11D-A13W-08 BLCA 5f0tb2ba-0351-4ce0-8b74-31aa3deecael
TCGA-DK-AIAC-0 I A-11D-A13W-08 BLCA a5dc17f5-abda-4534-b0f8-34b59ed4faa3
TCGA-DK-AlAD-01 A-11D-A13W-08 BI,CA 32398d56-8668-41b1-9c0b-c6aea6e3e787
TCGA-DK-A1AE-01A-11D-A 1 3W-08 BLCA abd2d959-d5ed-4eb3-9759-67eb1aa23325
TCGA-DK-A1AF-01A-11D-Al 3W-08 BLCA fbdcd719-1901-4e90-8e3c-71b05dc96da 1
TCGA-DK-A 1 AG-01A-11D-A13W-08 BLCA 7d2a22eb-7344-4cba-ad7d-94c3f9ef3d7c
TCGA-DK-A2HX-01A-12D-A18F-08 BLCA a8f0d416-2102-43ea-9cf1-465c37f9642a
TCGA-DK-A2I1-01A-11D-A17V-08 BLCA f350676a-e308-42fe-8297-9d18ba7027b1
TCGA-DK-A212-0 1A-11D-A17V-08 BLCA 537e0d59-ddlc-479e-877f-eb9523c0967e
TCGA-DK-A2I4-01A-11D-A21A-08 BLCA d68074b8-ce96-4dc5-b14c-3bbc7ba92ad9
TCGA-DK-A216-01A-12D-A18F-08 BLCA 97a755af-ca00-4116-8a32-0984dbfb1585
TCGA-DK-A3IK-01A-32D-A21A-08 BLCA f730e341-8102-4405-95e2-46a3455a35cc
TCGA-DK-A3IL-0 1 A-11D-A20D-08 BLCA 4838b5a9-968c-4178-bffb-3fafe1f6dc09
TCGA-DK-A3IM-01A-11D-A20D-08 BLCA 780f4201-4e59-47b8-b3b7-d322a6162b2d
TCGA-DK-A31N-01A-11D-A20D-08 BLCA 173c1518-6bcb-4e25-a119-de32dab91286
TCGA-DK-A3IQ-01A-31D-A20D-08 BLCA c3da3cc2-2299-4a3e-9de8-7a1d0a10345d
TCGA-DK-A1311S-01A-21D-A21A-08 BLCA 92a59313-da12-4896-b164-fd2d50684638
TCGA-DK-A3IT-01A-31D-A20D-08 BLCA 07db4596-cb49-4a32-bc99-3b202ffe61a2
TCGA-DK-A3IU-01A-11D-A20D-08 BLCA 52de410f-3ce3-4ee6-87f3-8ec2e829962f
TCGA-DK-A3IV-01A-22D-A2 IA-08 BLCA 7cecfbbc-5fe4-4413-95fd-07533aacbb73
TCGA-E5-A2PC-01A-11D-A202-08 BLCA 62b9f71c-2dab-455a-a454-579e8843f712
TCGA-FD-A3B3-01A-12D-A202-08 BLCA 8e9fb61d-c90d-440b-857a-12e1048435ea
TCGA-FD-A3B4-01A-12D-A202-08 BLCA df922c85-5a10-487f-a9d5-220d5090e2e4
1CGA-FD-A3135-01A-11D-A20D-08 BLCA dO5f9681-7ba9-4231-aae6-1d2c14c1t22d7
TCGA-FD-A3B6-01A-21D-A20D-08 BLCA 36524c53-ac54-4a42-a982-bed2e4354268
TCGA-FD-A3B7-01A-31D-A20D-08 BLCA fc76c5bd-315d-4981-ae53-705f40d2c078
TCGA-FD-A3B8-01A-31D-A20D-08 BLCA 7957bb77-8329-43a0-b1a8-140f2cb6b9 lb
TCGA-FD-A3N5-01A-11D-A21A-08 BLCA 418a3dec-96ff-4719-becb-ela8260cce21
TCGA-FD-A3N6-01A-I ID-A21A-08 BLCA d4615ca0-b5c7-4a5c-8593-bd50034a78ae
TCGA-FD-A3NA-01A-11D-A2I A-08 BLCA d079a32c-270b-4c43-8372-884e810c48ed
TCGA-02-A2EC-01A-11D-A17V-08 BLCA 1376c881-cea5-4470-8dc1-63c69f201570
TCGA-G2-A2EF-01A-12D-A18F-08 BLCA 4e5917bd-2cb1-438c-a46c-5d8ca5b2fdOe
TCGA-G2-A2EJ-01A-11D-A17V-08 BLCA 82f98ff9-7161-45c3-8107-033b47e25f21
TCGA-G2-A2EK-0 I A-22D-A I 8F-08 BLCA eb73bb35-af99-47b8-8bbb-
33b5374e5c74
TCGA-02-A2EL-01A-12D-A18F-08 BLCA 56924619-0724-4b3e-9c53-27c27d3789d6
150

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-G2-A2E0-01A-11D-A17V-08 BLCA ebb5cdb6-df4a-436d-b4a6-1655d263e3dd
TCGA-G2-A2ES-01A-11D-A17V-08 BLCA 5c628df6-a848-4177-87b8-714788118980
TCGA-C12-A31E-01A-11D-A20D-08 BLCA ebacd09f-c204-4cd2-a087-07bc4f2c5b74
TCGA-GC-A3I6-01A-11D-A20D-08 BLCA 372feefe-ee84-4833-8651-8f023f38a56a
TCGA-GC-A3RB-01A-12D-A21Z-08 BLCA eaf54383-4286-4416-9b18-be1081797df2
TCGA-GD-A2C5-01A-12D-A17V-08 BT,C A 2b142863-b963-4cc9-8f8f-
c72503c93390
TCGA-GD-A30P-01A-21D-A21Z-08 BLCA 3e02d723-691a-448c-85e2-4e39a3696ba5
TCGA-GD-A30Q-01A-32D-A21Z-08 BLCA fb985b3d-b0f7-42a0-bc3c-f71d9c5f78d8
1CGA-GD-A30S-01A-12D-A21Z-08 BLCA 9b3e164d-aaa0-4bb5-b7b8-6264b2746a47
TCGA-GV-A3JV-01A-11D-A21Z-08 BLCA 5fed4b8a-4b59-4424-bbfl-bc73ce041361
TCGA-GV-A3JW-01A-11D-A20D-08 BLCA 4534413b-d0d0-4b34-a3d44821705485ae
TCGA-GV-A3JX-01A-11D-A20D-08 BLCA 21525d6f-4222-4e0a-9f07-8adbbd55c54f
TCGA-GV-A3JZ-01A-11D-A21A-08 BLCA 074fc904-0a0e-4114-b569-89d51e7a89db
TCGA-GV-A3QG-01A-11D-A21Z-08 BLCA 90534196-b1d8-4054-b4d5-1d29943b52bc
TCGA-GV-A3QT-01A-11D-A217-08 BI,CA 33a9da52-5471-456f-84cb-13c5de5b0994
TCGA-H4-A2H0-01A-11D-A17V-08 BLCA 2e327841-eef0-42dd-883e-7d5b5a0d3a93
TCGA-H4-A2HQ-01A-11D-A17V-08 BLCA 94108975-b7a0-40ba-ad39-e44cc62e8cc0
1CGA-HQ-A20L-01A-11D-A202-08 BLCA 61324839-e90a-4912-a9c9-629d7b125fe9
TCGA-A1-AOSB-01A-11D-A142-09 BRCA db9d40f0-bfce-4c3b-a6c2-41c5c88982f1
TCGA-A1-AOSD-01A-11D-A10Y-09 BRCA 1847727f-ea57-4e2e-84e5-a10e764c9096
TCGA-A1-AOSE-01A-11D-A099-09 BRCA 0539776c-3943-41d0-972c-8dc833a603e5
TCGA-A1-AOSF-01A-11D-A142-09 BRCA b291200e-3c22-411a-85d0-fbe1570acda2
TCGA-Al-AOSG-01A-11D-A142-09 BRCA 39642c6d-9191-4746-8a9d-62d437bfdce8
TCGA-A 1 -AOSH-01A-11D-A099-09 BRCA 473d6ae4-162a-4136-b44f-fad42529a3la
TCGA-A1-AOSI-01A-11D-A142-09 BRCA e218c272-a7e1-4bc9-b8c5-d2d1c903550f
TCGA-A1-AOSJ-01A-11D-A099-09 BRCA a55c6a44-c0f5-4300-8df4-4a70befe2d3b
TCGA-Al-AOSK-01 A-12D-A099-09 BRCA dl b43161-cbc 1 -4bf6-b80b-
a72a2e5e1150
TCGA-A1-AOSM-01A-11D-A099-09 BRCA 2057b341-ff5c-45ef-83bb-005e29b2e740
TCGA-A1-AOSN-01A-11D-A142-09 BRCA 1b8c19314-acc2-48ee-9ca8-a327eb0463c2
TCGA-A1-A0S0-01A-22D-A099-09 BRCA b3568259-c63c-4eb1-bbc7-af711ddd33db
TCGA-A1-AOSP-01A-11D-A099-09 BRCA d3ae9617-b6cd-4d98-b631-39bd4afd3c4e
TCGA-Al-AOSQ-01A-21D-A142-09 BRCA 9055ddce-a0ff-4980-af86-c07f949acbc3
TCGA-A2-A04N-01A-11D-A10Y-09 BRCA 389dd52b-a7b7-46f0-83ae-308e485466a8
TCGA-A2-A04P-01A-31D-A128-09 BRCA a85cf239-ff51-46e7-9688-4c2cb49c66b9
TCGA-A2-A04Q-01A-21W-A050-09 BRCA 02eb17d4-9e9e-402-96b0-90ccdda3f167
1CGA-A2-A04R-01A-41D-A117-09 BRCA 1f8e4326-dfc7-4635-a967-a9207a392748
TCGA-A2-A04U-01A-11D-A10Y-09 BRCA f819433a-44db-4022-abdb-d6123cfa30b2
TCGA-A2-A04V-01A-21W-A050-09 BRCA 89501861-2778-4b88-9a44-939fed99850d
TCGA-A2-A04W-01A-31D-A10Y-09 BRCA 7822a6b1-68c8-4675-993c-c4b54a510c09
1CGA-A2-A04X-01A-21W-A050-09 BRCA 66a73891-2tea-450c-8224-0865d98b4346
TCGA-A2-A04Y-01A-21W-A050-09 BRCA 3669bbbd-2e75-46.57-a5a8-8eebe25a97c2
151

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-A2-AOCL-01A-11D-A10Y-09 BRCA a630ed59-dd23-45e1-aa16-4f7a98e32728
TCGA-A2-A0CM-01A-31W-A050-09 BRCA fe8023d4-5476-4c58-6170-cbf65cdd4327
TCGA-A2-A0CP-01A-11W-A050-09 BRCA a776e274-fe9f-49a9-83a6-95ca6819c966
TCGA-A2-AOCQ-01A-21W-A050-09 BRCA fa0d7183-8757-495-8762-2366aldbd508
TCGA-A2-AOCS-01A-11D-AlOY-09 BRCA fe966832-cb86-4499-948a-5124a43d5c95
TCGA-A2-AOCT-01A-31W-A071-09 BRCA 26412ad8-abda-4cf843f68-59dbc&30031e
TCGA-A2-AOCU-01A-12W-A050-09 BRCA a9aa68af-f5fe-4ac0-987f-8af49685c231
TCGA-A2-AOCV-01A-31D-A10Y-09 BRCA 5d1dead5-d9a5-42d3-a703-4c38ad6e8f57
1CGA-A2-AOCIA'-01A-21D-A1 0Y-09 BRCA da4f0f85-616f-40fa-95c6-
524d70d7ac4d
TCGA-A2-AOCX-01A-21W-A019-09 BRCA 975adb76-3561-41a0-959a-68da470816c7
TCGA-A2-AOCZ-01A-11W-A050-09 BRCA 95d5c606-367a-4665-6663-dcea3f42e2a2
TCGA-A2-A0D0-01A-11W-A019-09 BRCA 3f20d0fe-aaa1-40f1-62c1-7f070f93aef5
TCGA-A2-A0D1-01A-11W-A050-09 BRCA a762809c-15c9-485e-ad7a-ef28427750e9
TCGA-A2-A0D2-01A-21W-A050-09 BRCA 05656575-69e7-4745-a89d-ca056865559
TCGA-A2-A0D3-01 A-11D-A10Y-09 BRCA 8183420e-7f44-4024-63db-6653ad293988
TCGA-A2-A0D4-01A-11W-A019-09 BRCA f3accede-1716-4d44-bad4-5427a9ebd675
TCGA-A2-A0EM-01A-11W-A050-09 BRCA OcOlc668-9edd-4965-6247-ee7e68124f48
1CGA-A2-A0EN-01A-13D-A099-09 BRCA 12362ad7-6866-4e7a-9ec6-8a0a68df8896
TCGA-A2-A0E0-01A-11W-A050-09 BRCA 8e2f9e67-0660-47ae-686e-652e99fa69ca
TCGA-A2-A0EQ-01A-11W-A050-09 BRCA 2c449ea9-c3ff-4726-8566-5933e2b7056d
TCGA-A2-A0ER-01A-21W-A050-09 BRCA 3 led187e-9bfe-4ca3-8c6b-10c 1
e0184331
TCGA-A2-AOES-01A-11D-A10Y-09 BRCA 64d42c62-5c2d-49f5-856e-72beef88044d
TCGA-A2-AOET-01A-31D-A045-09 BRCA 17640023-4ade-4c7d-ae73-5c 1
OddcbcOfb
TCGA-A2-A0EI J-01A-22W-A071-09 BRCA de30da8f-903f-428e-a63d-59625fc858a9
TCGA-A2-A0EV-01A-11W-A050-09 BRCA 94336f4f-23ba-4fe7-9503-1ad243d74225
TCGA-A2-A0EW-01A-21D-A10Y-09 BRCA a045a04e-4f76-4f9a-a733-47ad24475496
TCGA-A2-A0I-1X-01A-21W-A050-09 BRCA 9308f50c-1320-4c45-ace7-38f43661%36
TCGA-A2-A0EY-01A-11W-A050-09 BRCA a8cde596-e3f5-4620-9e7f-45d079893176
TCGA-A2-AOST-01A-12D-A099-09 BRCA dd669f44464d-4afc-a5ac-5f7769d1d643
TCGA-A2-AOSU-01A-11D-A099-09 BRCA 6ceaf20f-1458-4f7f-954a-e2f58ed163bf
TCGA-A2-AOSV-01A-11D-A099-09 BRCA 6d3206c6-Oca8-462b-a160-61719217f9c7
TCGA-A2-AOSW-01A-11D-A099-09 BRCA 7f6d2807-a5b6-4030-a299-524ec3a64543
TCGA-A2-AOSX-01A-12D-A099-09 BRCA 6546c3le-bdcc-4ad5-998e-5a9c542f83bb
TCGA-A2-AOSY-01A-31D-A099-09 BRCA efaa9c0b-c146-4141-648c-cc2c6b89a673
TCGA-A2-A0T0-01A-22D-A099-09 BRCA 3c107ce4-a6ac-4696-61c0-cd8667465766
1CGA-A2-A01'1-01A-21D-A099-09 BRCA 9515373a-d982-45fa-b8f9-363f9ba8649t
TCGA-A2-A0T2-01A-11W-A097-09 BRCA c7918143-dbce-4563-8d24-2993a9e2b7f4
TCGA-A2-A0T3-01A-21D-A10Y-09 BRCA 0ca02966-363a-48ec-8ade-5591e8e8629f
TCGA-A2-A0T4-01A-31D-A099-09 BRCA OfIblfda-4956-498a-b8ff-e98b5d64e509
TCGA-A2-A01'6-01A-11D-A099-09 BRCA e4dcb280-c309-4ebb-a58d-e6389a0306ee
TCGA-A2-A0T7-01A-21D-A099-09 BRCA 3ea4d98d-f8d9-433e-94f1-60199bfdb198
152

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-A2-AOYC-01A-11D-A117-09 BRCA 4cccf7dc-7c53-409f-a6b1-f86e0f07250b
TCGA-A2-AOYD-01A-11D-A1OG-09 BRCA 30c9f9c5-90b2-4c73-bcc5-eb6a3d31f496
TCGA-A2-AOYF-01A-21D-A1OG-09 BRCA 11571107-fe70-4140-afff-f4792a4fd473
TCGA-A2-AOYG-01A-21D-A1OG-09 BRCA bf82035c-9cd1-4355-acdd-8a007708e976
TCGA-A2-AOYH-01A-11D-A 0G-09 BRCA e5558a39-eab2-4216-ba88-b63c2de48b01
TCGA-A2-AOYI-01A-3 ID-Al OM-09 BRCA 6d2ae968-c977-41165-869a-
5e96ff3216e9
TCGA-A2-AOYJ-01A-11D-AlOG-09 BRCA 3fe8e99f-dce5-4df9-983e-efe63d56bdd5
TCGA-A2-AOYK-01A-22D-A117-09 BRCA 7c27f81e-62fb-478c-9cee-8e20db9300f2
TCGA-A2-AOYL-01A-21D-AlOG-09 BRCA 3cc80b41-603d-4735-85c7-71f540dc6e5c
TCGA-A2-AOYM-01A-11D-A1 0G-09 BRCA 1125ec93-6d24-4537-9c89-526f2d6b2299
TCGA-A2-AOYT-01A-11D-A10G-09 BRCA 827c6a2f-fb lb-4845-9cb1-11013a16da3f
TCGA-A2-A1FV-01A-11D-A13L-09 BRCA 51b7064c-d9fc-4312-ad25-b014ef81c821
TCGA-A2-A1FW-01A-11D-A13L-09 BRCA 6ccdb42e-lad1-4175-b83a-a24b019dc640
TCGA-A2-A1FX-01A-11D-A13L-09 BRCA 0d3dd7a0-ad8d-46cc-86c4-c1994a7b4b74
TCGA-A2-AlFZ-01A-51D-A17G-09 BRCA 0f7038bb-fd25-468e-8bd9-dcd4312d13cb
TCGA-A2-A1G0-01A-11D-A13L-09 BRCA f7eacf95-478d-4d81-a5e3-f5a8938c83ec
TCGA-A2-A1G1-01A-21D-A13L-09 BRCA afe70076-1044-4fdd-bebc-14a97b1a8363
TCGA-A2-A1G4-01A-11D-A13L-09 BRCA 420a4771-6376-4b52-a2e3-e62aaf4d4ed6
TCGA-A2-A1G6-01A-11D-A13L-09 BRCA c012bce9-de13-4e32-a29e-8a1364e16ea96
TCGA-A2-A259-01A-11D-A16D-09 BRCA 93febbOa-587c-47f2-9a59-117f7aa475c5
TCGA-A2-A25A-01A-12D-A16D-09 BRCA 5739a7e1-7fa3-434c-ble3-c0a9e570c858
TCGA-A2-A25B-01A-11D-A167-09 BRCA 6e839eaf-ldbb-43f5-8846-c980e05540c7
TCGA-A2-A25C-01A-11D-A167-09 BRCA 2411fc4a-c0d7-4a60-a861-f4d954efled5
TCGA-A2-A25D-01A-12D-A16D-09 BRCA 5613152c3-9de5-4b1c-b6b4-0116cb7ce097
TCGA-A2-A25E-01A-11D-A167-09 BRCA 8dce6a9d-ecb7-4699-9fda-lb09blb1de43
TCGA-A2-A25F-01A-11D-A167-09 BRCA led40576-4f1c-4cf6-8eea-e816c5d73d90
TCGA-A7-A0CD-01A-11W-A019-09 BRCA d29ba065-28ca-4dfb-9588-06be857f67b2
TCGA-A7-AOCG-01A-11W-A019-09 BRCA 351275c7-70ca-4ddc-be76-a6ff4dc7655e
TCGA-A7-AOCJ-01A-21W-AC19-09 BRCA c9f6a65e-ae20-410d-a397-34aef0818ff3
TCGA-A7-AODA-01A-31D-A 1 OY-09 BRCA 878337fe-9f41-44f5-9760-3977e7d75308
TCGA-A7-A13D-01A-13D-Al2Q-09 BRCA 418e916b-7a4e-4fab-8616-15dcec4d79f8
TCGA-A7-A13G-01A-11D-A13L-09 BRCA ef847b83-eb88-435b-bcfd-4b51d4dfa5fe
TCGA-A7-A26E-01A-11D-A167-09 BRCA 73651880-ctbd-4f8d-8031-a14b3ac65454
TCGA-A7-A26F-01A-21D-A167-09 BRCA fc73db72-d0ac-48c10-b809-2f7540482ec5
TCGA-A7-A26G-01A-21D-A167-09 BRCA 36d1a85e-a09b-4537-86e0-eaf1eb03aec18
TCGA-A7-A26II-01A-11D-A167-09 BRCA fbeade79-28ef-4e85-8282-67e691630ca3
TCGA-A7-A264-01A-11D-A167-09 BRCA 81fff2d1-d6ed-4963-a5f6-5899cde6b359
TCGA-A7-A26J-01A-11D-A167-09 BRCA be2ca34f-5c15-4b38-a207-52df296a98ee
TCGA-A8-A06N-01A-1 I W-A019-09 BRCA 03d266a3-eb3e-4893-af6b-cb70d197d981
TCGA-A8-A060-01A-11W-A019-09 BRCA 29cd408e-a04b-418a-85e2-6ef95840ddbc
TCGA-A8-A06P-01A-11W-A019-09 BRCA 239b3d55-c5d6-4478-967b-1cbad3c03c81
153

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-A8-A06Q-01A-11W-A050-09 BRCA 473d5422-978a-48be-be32-2b7516d6d2d5
TCGA-A8-A06R-01A-11D-A015-09 BRCA c6b0Oeff-6c4e-4d79-a9b1-8th1f3090816
TCGA-A8-A06T-01A-11W-A019-09 BRCA llec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7
TCGA-A8-A06U-01A-11W-A019-09 BRCA 277c2e8a-dd28-4b8f-96d3-ea790a1986b6
TCGA-A8-A06X-01A-21W-A019-09 BRCA de306402-3a55-4996-b786431738f13dd3
TCGA-A8-A06Y-01A-21W-A019-09 BRCA 3bede568-d8b6-44c0-99e0-a9b6c7d4ce80
TCGA-A8-A06Z-01A-11W-A019-09 BRCA f540c4f8-75b3-47d7-a7cf-53cbt7a2c814
TCGA-A8-A075-01A-11D-A099-09 BRCA 085dd125-1f95-46aa-a480-2965090e8591
1CGA-A8-A076-01A-21W-A019-09 BRCA dfa06058-320b-4cc6-ac18-a42e59019 b
lc
TCGA-A8-A079-01A-21W-A019-09 BRCA 06221ce8-ab65-4694-945b-059b9c15ede4
TCGA-A8-A07B-01A-11W-A019-09 BRCA 734421b9-ed55-45b0-9ad5-51bc754ebe90
TCGA-A8-A07C-01A-11D-A045-09 BRCA 6ab33f67-b69d-4a2d-a424-841f5tbf1ee7
TCGA-A8-A07E-01A-11W-A050-09 BRCA fa018a20-2c26-4d47-831f-75280b6464df
TCGA-A8-A07F-01A-11W-AC19-09 BRCA 73d907e6-4ba0-431f-a009-8366644thaf0
TCGA-A8-A07G-01A-11W-A050-09 BRCA 49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc
TCGA-A8-A07I-01A-11W-A019-09 BRCA 7718c3f0-
1c90-4940-bc30-ea4f417851bb _
TCGA-A8-A07J-01A-11W-A019-09 BRCA c8eac36c-c3a7-4c88-b928-832ab279045b
TCGA-A8-A07L-01A-11W-A019-09 BRCA 40086f29-061e-4058-8e8E4c48191f52aa
TCGA-A8-A070-01A-11W-A019-09 BRCA 4574b64d-8848-46e4-913e-5d318c1f6162
TCGA-A8-A07P-01A-11W-AC19-09 BRCA 2b88ff64-bf43-43e8-9ea9-0de571520d72
TCGA-A8-A07R-01A-21W-A050-09 BRCA f377217c-399f-4b3f-9090-fa5189b2bfc6
TCGA-A8-A07U-01A-11W-A050-09 BRCA e6409415-8453-489d-a731-49257cade2a3
TCGA-A8-A07W-01A-11W-A019-09 BRCA 9bc8dbab-c700-498c-80-ccc62c911349
TCGA-A8-A07Z-01A-11W-A019-09 BRCA e4af33f9-f5fe-4e52-8ca0-991bbce2270d
TCGA-A8-A081-01A-11W-A019-09 BRCA d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80
TCGA-A8-A082-01A-11W-A019-09 BRCA 575d25ea-eae7-423a-9464-d3b2806b19eb
TCGA-A8-A083-01A-21W-A019-09 BRCA 1904e458-
1a6c-4e91-88cc-10ee154ded5b ¨
TCGA-A8-A084-01A-21W-A019-09 BRCA 6f6f7048-5b7a-4827-af2b-cfecc4a60025
TCGA-A8-A085-01A-11W-A019-09 BRCA cbdea951-3dc9-42c2-bfdd-3796c30e928e
TCGA-A8-A086-01A-11W-A019-09 BRCA 13d89926-9e4c-434f-80b4-4tb15e4426f6
TCGA-A8-A08A-01A-11W-A019-09 BRCA 0257d030-6d78-452c-9dcc-79fe50533543
TCGA-A8-A08B-01A-11W-A019-09 BRCA 267a951b-2967-4849-9ea7-d2205838fcc7
TCGA-A8-A08F-01A-11W-AC19-09 BRCA 4975eeda-984e-4a7a-8193-43d8b6e027 lc
TCGA-A8-A08G-01A-11W-A019-09 BRCA 8da61928-e935-4a33-8e46-840e637163d7
TCGA-A8-A08H-01A-21W-A019-09 BRCA 26161c064816-489a-8800-e0a68a4ce78a
TCGA-A8-A081-01A-11W-A019-09 BRCA 4525400d-
0a2c-4cc7-9c71-9ad6d9faf93f ¨
TCGA-A8-A08J-01A-11W-A019-09 BRCA ae458901-e900-4aaa-bde6-3eda8912flx15
TCGA-A8-A08L-01A-11W-A019-09 BRCA 8b819a59-f0c1-456a-9e81-64b5bed025c1
TCGA-A8-A080-01A-21W-A071-09 BRCA bc1398b9-d4ec-43e8-86bc-7025ataf93d5
TCGA-A8-A08P-01A-11W-A019-09 BRCA 2fbe3da3-ce62-4edf-933b-367f983e221 a
154

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-A8-A08R-01A-11W-A050-09 BRCA 05362091-8e04-46e2-81e7- 1
efddc0d8c63
TCGA-A8-A08S-01A-11W-A650-09 BRCA 9c981525-80af-4f79-b94a-be00131ab872
1CGA-A8-A08T-01A-21W-A019-09 BRCA af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e
TCGA-A8-A08X-01A-21W-A019-09 BRCA 67c7d350-5c82-49b0-a7eb-6ca829ffcbc9
TCGA-A8-A08Z-01A-21W-A019-09 BRCA 96afb6c10-29ea-4bd5-8a9d-130e42954707
TCGA-A8-A090-01A-11W-A019-09 BRCA 783e4c13-8fa5-4591-9453-1e59cal67e10
TCGA-A8-A091-01A-11W-A019-09 BRCA 6618f367-c782-43a0-b5c8-a53d9bda6722
TCGA-A8-A092-01A-11W-A019-09 BRCA 732dd0ab-c869-4d35-973f-9db064680fb1
TCGA-A8-A093-01A-11W-A019-09 BRCA 8f64ba22-0958-4fdb-8161-f83cfe57c95d
TCGA-A8-A094-01A-11W-A019-09 BRCA ab9bf7a6-688e-4388-9682-6b1616723fde
TCGA-A8-A095-01A-11W-A019-09 BRCA dl 6f025a-4187-4632-b833-02a3ffa54210
TCGA-A8-A096-01A-11W-A019-09 BRCA 8a411a0a-ec66-4d9f-b0e4-f1c1f969d605
TCGA-A8-A097-01A-11W-A050-09 BRCA 15ca7c47-131a-4dd7-b0a7-584577b4b02c
TCGA-A8-A099-01A-11W-A019-09 BRCA 1066cb38-e051-42fa-a8bc-20b659c17a13
TCGA-A8-A09A-01A-11W-A019-09 BRCA ecfedc29-5c31-4d3d-b599-fc0alcObeafa
TCGA-A8-A09B-01A-11W-A019-09 BRCA a8be37d2-2743-4fde-9aae-2623b5a03b60
TCGA-A8-A09C-01A-11W-A019-09 BRCA b56cf2cb-bb2a-46b6-b3b4-84dd8b364984
TCGA-A8-A09D-01A-11W-A019-09 BRCA d0ef396f-4e9f-40ba-a09c-0a96832cabf9
TCGA-A8-A09E-01A-11W-A019-09 BRCA d6465963-5ea6-44a5-96b0-dff0b0fae4c4
TCGA-A8-A09G-01A-21W-A019-09 BRCA 3bd68e94-d902-4079-8fdb-16edcc9Odelc
TCGA-A8-A091-01A-22W-A050-09 BRCA 96d5070d-lfa9-4fa5-b2c9-472240dfd3b9
TCGA-A8-A09K-01A-11W-A019-09 BRCA d8cd7512-5ee5-4296-a781-a6a16ee94506
TCGA-A8-A09M-01A-11W-A019-09 BRCA 8e92515a-8049-4ebb-9117-a137c06e5d04
TCGA-A8-A09N-01A-11W-A019-09 BRCA 304a2945-f134-45c7-9eaa-c6c9c2435552
TCGA-A8-A09Q-01A-11W-A019-09 BRCA 51a8ac83-bafa-4df7-a52d-alelfb45799d
TCGA-A8-A09R-01A-11W-A019-09 BRCA 35ebf91d-6fec-4d28-9b21-493d0e14f8db
TCGA-A8-A09T-01A-11W-A019-09 BRCA e565da2b-4a3f-4bel-9cf7-2845145d1dbc
TCGA-A8-A09V-01A-11D-A045-09 BRCA 818f1a34-17c5-409a-b5f5-4a8576db0d44
TCGA-A8-A09W-01A-11W-A019-09 BRCA 9a2690ce-485f-4d4f-9673-d86f91be27a4
1CGA-A8-A09X-01A-11W-A019-09 BRCA 48e532ea-2af5-427a-a784-781e208cced6
TCGA-A8-A0A1-01A-11W-A019-09 BRCA 73aa20fe-b74b-41ae-88d3-2d5a66908c25
TCGA-A8-A0A2-01A-11W-A050-09 BRCA b681dba3-a608-47c2-9ae8-5d761d1e800e
TCGA-A8-A0A4-01A-11W-A019-09 BRCA 1fc4d542-86ac-42bc-9fbb-272c23e6aa72
TCGA-A8-A0A7-01A-11W-A019-09 BRCA 28be7b14-730d-44f7-bf93-a7590b4a08f8
TCGA-A8-A0A9-01A-11W-A019-09 BRCA 228e666-1dc6-4c01-8252-c557a8f53916
1CGA-A8-A0A13-01A-11W-A050-09 BRCA ad2a2f5d-dad6-4c03-6235-20810d6d34dc
TCGA-A8-A0AD-01A-11W-A071-09 BRCA 6e65111a-4f6e-4184-84b8-9e9e7a863632
TCGA-AC-A23C-01A-12D-A167-09 BRCA 91766158-e175-4270-bc01-8e853fc9f391
TCGA-AC-A23E-01A-11D-A159-09 BRCA 137cb73f-394a-459a-83e6-0b3c85c955cd
TCGA-AN-A03X-01A-21W-A019-09 BRCA 1177234e-e0a7-4185-b73d-48e0080c805d
TCGA-AN-A03Y-01A-21W-A019-09 BRCA f4849adc-b6e8-40bd-9de4-dc5bb37d2a79
155

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-AN-A041-01A-11W-A050-09 BRCA f18c7389-6c8d-485f-a7f7-a450a42e3719
TCGA-AN-A049-01A-21W-A019-09 BRCA 1d0c87ef-6840-4051-85d5-7fc2c544578c
1CGA-AN-A04A-01A-21W-A050-09 BRCA 7e8f250c-6162-4049-8559-5bfdf054b021
TCGA-AN-A04C-01A-21W-A050-09 BRCA c1302f79-cc50-487a-9db5-016df85e67d7
TCGA-AN-A04D-01A-21W-A050-09 BRCA 9407735 f-19e3-49d0-b783-cd9672dfa6a9
TCGA-AN-A0AJ-01A-11W-A019-09 BRCA 97fbce82-0eed-4d70-9af2-57918a4ea8da
TCGA-AN-AOAL-01A-11W-A019-09 BRCA 47849ee3-b59e-4ccf-a261-65f7e252b885
TCGA-AN-A0AM-01A-11W-A050-09 BRCA a238f21f-ca46-4759-b5b7-f8c3810dfbdb
TCGA-AN-AOAR-01A-11W-A019-09 BRCA a2d77acd-89db-4d2d-89d7-dlcc58cf576b
TCGA-AN-AOAS-01A-11W-A019-09 BRCA 2257c942-1274-47e7-86ad-b92ecfafc205
TCGA-AN-AOAT-01A-11D-A045-09 BRCA f848b66f-bd9e-4fba-afd4-eb58848d1ef4
TCGA-AN-A0FD-01A-11W-A050-09 BRCA abae6f4c-2378-41bd-adea-1739e6629b22
TCGA-AN-AOFF-01A-11W-A050-09 BRCA c045e46c-50bf-449e-bb40-29ccffbbd49c
TCGA-AN-AOFJ-01A-11W-A019-09 BRCA 6b988737-0504-42bb-8c75-d70d7a312e68
TCGA-AN-AOFK-01A-11W-A050-09 BRCA a765959e-b234-427d-aade-855d6d498109
TCGA-AN-A0FL-01A-11W-A050-09 BRCA 18ee29ae-fe36-49a3-9843-e0757c69a70d
TCGA-AN-AOFN-01A-11W-A050-09 BRCA 8f583981-b257-43ee-9c9e-71a192a49d38
TCGA-AN-AOFS-01A-11W-A050-09 BRCA 9bb76d20-cefb-4f7a-80c2-aa2178e302a9
TCGA-AN-AOFT-01A-11W-A050-09 BRCA 0598fc5f-9651-4ace-bf4e-56759d544e52
TCGA-AN-AOFV-01A-11W-A019-09 BRCA c70259c14561-4307-9829-6852815baa87
TCGA-AN-AOFW-01A-11W-A050-09 BRCA 5afde43a-194c-4876-b244-2132aef2f505
TCGA-AN-A0FX-01A-11W-A050-09 BRCA 2523cf22-1a16-42be-8560-833e02031e3c
TCGA-AN-AOFY-01A-11W-A050-09 BRCA a6a8bd08-0e60-442d-adce-0e020177f82c
TCGA-AN-AOFZ-01A-11W-A050-09 BRCA d77f59f7-8cff-41f3-albb-0de1452404f4
TCGA-AN-A0G0-01A-11W-A050-09 BRCA 9cb55dd2-a956-4dfc-8631-04722c49819f
TCGA-AN-A0XL-01A-11D-A10M-09 BRCA 1b08a181-a73b-4506-aaa3-3521f2c57207
TCGA-AN-A0XN-01A-21D-A1 0G-09 BRCA 94a6c172-25e2-4438-945c-9b310f89ae22
TCGA-AN-A0X0-01A-11D-A1 0G-09 BRCA f63863f5-cb60-4961-a5b4-ed5ealfb3dc8
TCGA-AN-AOXP-01A-11D-A117-09 BRCA 6179b498-2cea-4f7a-82a8-b7cc71431ca8
TCGA-AN-AOXR-01A-11D-A1 0G-09 BRCA e70c7492-3a84-49c7-80ea-8f508b53dc40
TCGA-AN-AOXS-01A-22D-AlOG-09 BRCA f1b52680-556f-404f-a956-7700f4a1e7aa
TCGA-AN-AOXT-01A-11D-A100-09 BRCA 35309161-95fd-4bec-abb7-859d9ee19785
TCGA-AN-A0XU-01A-11D-A1 0G-09 BRCA 537c5818-eb89-4b46-8915-2bb2b9e4545f
TCGA-AN-AOXV-01A-11D-A1 0G-09 BRCA 6f0e5a39-e2c7-4a93-bd63-flbab 1
e7c16e
TCGA-AN-AOXVV-01A-11D-A10G-09 BRCA 2000ba9e-201b-4634-a2cf-666e1f6710dc
TCGA-AO-A03L-01A-41W-A071-09 BRCA 743a29c4-elcc-457 a-8406-765f1 a
lbc114
TCGA-AO-A03N-01B-11D-A10M-09 BRCA ef5987f1-46ac-430a-b94a-49afa0e286d4
TCGA-AO-A030-01A-11W-A019-09 BRCA 1578b356-7f42-4722-bc54-cd5f37954f6a
TCGA-AO-A03P-01A-11W-A019-09 BRCA 185c5e15-c068-4a72-805e-468624b1958a
TCGA-AO-A03R-01A-21W-A050-09 BRCA 6020c4e3-fled-4ef0-ae83-e09c87756d56
TCGA-AO-A03T-01A-21W-A050-09 BRCA cbea8660-da66-417c-9940-clec35aa2049
156

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-AO-A03U-01B-21D-A10M-09 BRCA 1e0ecd57-5c7d-4495-874d-9e286c999c22
TCGA-AO-A03V-01A-11D-A10Y-09 BRCA d88c365f-366a-49d5-9860-b930aab3eb lb
TCGA-AO-A0J2-01A-11W-A050-09 BRCA 84b66e02-1637-4424-6752-36317861fe74
TCGA-AO-A013-01A-11W-A050-09 BRCA ff706355-867e-4968-99ad-Oaf4e24ece51
TCGA-AO-A0J4-01A-11W-A050-09 BRCA 7667 f49c-449d-44ce-bab8-02a491bb6775
TCGA-AO-A0J5-01A-11W-A050-09 BRCA 93ae73f6-c355-47be-a355-faa78c0632d4
TCGA-AO-A0J6-01A-11W-A050-09 BRCA 7d21a0c4-03c7-4641-8b4d-7a5877960360
TCGA-AO-A0J7-0 I A- I I W-A050-09 BRCA a53056d9-e8bd-4cb 1-ad67-
85879ccc925d
TCGA-AO-A0J8-01A-21D-A045-09 BRCA 24ba5501-8097-4af6-1112c-bb6dcbelOcac
TCGA-AO-A0J9-01A-11W-A050-09 BRCA 9932232f-a7b0-4962-9b14-adb8316a4661
TCGA-AO-AOJA-01A-11W-A071-09 BRCA 0215d4f1-6697-4e8f-afc4-ff7c6439e56d
TCGA-AO-A0J13-01A-11W-A071-09 BRCA 8f4f06be-2a16-4ae2-9dd4-5d87f480810b
TCGA-AO-AOJC-01A-11W-A071-09 BRCA 120f55df-5d1d-4073-a21a-632c892d3da9
TCGA-AO-A0JD-01A-11W-A071-09 BRCA 9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32
TCGA-AO-AOJE-01A-11W-A071-09 BRCA 4f311714-ebb4-47f6-6471-62c6951d9066
TCGA-AO-A0JF-01A-11W-A071-09 BRCA 191caala-5a68-4db5-b42a-fIc5964b0b0d
TCGA-AO-AOJG-01A-31D-A099-09 BRCA cf7ec093-5040-43db-949c-f426795a7488
TCGA AO AOJI 01A 21W A100 09 BRCA 861297ec-2c88-4717-ae63-eb8e21fe8c52
TCGA-AO-A0B-01A-11W-A071-09 BRCA 812191d1-6711-4efd-8932-c76159b6Offb
TCGA-AO-AOJL-01A-11W-A071-09 BRCA 56a22648-be92-402c-a225-bcaa44a7e612
TCGA-AO-A0JM-01A-21W-A071-09 BRCA f070142b-
f44e-4264-8919-dde7d02ad835 .,
TCGA-AO-A124-01A-11D-A10M-09 BRCA 987528ac-437a-4eb8-a335-412076d5c006
TCGA-AO-A125-01A-11D-AIOM-09 BRCA 17669c6d-2eeb-4d56-ac72406bfa1b7e42
TCGA-AO-A126-01A-11D-A 1 0M-09 BRCA 851139644-6f19-40dc-94c1-
0afc93ee4981
TCGA-AO-A129-01A-21D-A10M-09 BRCA cdf43c25-3ba7-4073-a92d-4a97f651f4a8
TCGA-AO-Al2A-01A-21D-A10Y-09 BRCA 77e7b41a-d4c8-42ee-ae6c-da 1 5ca3634d9
TCGA-AO-A120-01A-11D-A 1 0M-09 BRCA 865ebd77-767d-4a27-6945-df5ec8d1f86a
TCGA-AO-Al2D-01A-11D-A10Y-09 BRCA b3065c1e-3067-4f08-8c82-46f1 Oc 1
ec279
TCGA-AO-Al2E-01A-11D-A10M-09 BRCA b3990b59-e2f4-4759-8eb0-11ad3c34ac50
TCGA-AO-Al2F-01A-11D-AlOY-09 BRCA d1617673-57c2-40c1-a970-f3692ee1 3cf3
TCGA-AO-Al2G-01A-11D-A1 0M-09 , BRCA , 5b9d3741-2aa3-489b-93e6-
3b5376680d48
TCGA-AO-Al2H-01A-11D-AlOY-09 BRCA 5a535c49-d42e-43c6-9d32-dc76f28d4f0f
TCGA-AO-A1K0-01A-31D-A188-09 BRCA 2cdecb2b-40b1-4419-bcd9-101cee78966c
TCGA-AO-A1KP-01A-11D-A 1 3L-09 BRCA bc36db60-3f6b-42c4-b03e-b7c74c3dda5c
TCGA-AO-A1KR-01A-12D-A142-09 BRCA d3b598d8-8a3b-4506-aa98-9fbc5b51afd4
TCGA-AO-A 1KS-01A-11D-A13L-09 BRCA 21074661-460f-4adc-b406-5801688a3ae9
TCGA-AO-A1KT-01A-11D-A 13E-09 BRCA 97b33dc3-6a62-419a-aa6c-cb84c9192102
TCGA-AQ-A04H-01B-11D-A10M-09 BRCA 73c13e04-1400-4ebb-aa80454becbe036c
TCGA-AQ-A04J-01A-02W-A050-09 BRCA cce21f2b-784b-4fa0-9809-ae532c528f8e
TCGA-AQ-A04L-01B-21D-A10M-09 BRCA e8d7feb0-981b-4ba0-b4d4-fa9850644446
TCGA-AQ-A0Y5-0 IA-I 1D-A14K-09 BRCA 4aa80fbd-a337-4966-9371-223cbcfbc85d
157

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-AQ-A1H2-01A-11D-Al 3L-09 BRCA 1ab2dc63-51ce-4a96-b7ad-f0d9eb198d10
TCGA-AQ-A1H3-01A-31D-Al 3L-09 BRCA 1 fa2017e-ce08-4a16-bdf6-f9bf1296c834
TCGA-AR-AOTP-01A-11D-A099-09 BRCA bee5b9c8-739e-4530-b140-cd2b898d7afd
TCGA-AR-AOTQ-01A-11D-A099-09 BRCA b266fffc-263d-4b0f-a781-7437e41061b2
TCGA-AR-AOTR-01A-11D-A099-09 BRCA 58ca1 lb f-17b0-4-eff-b210-
5b85d8e66ef5
TCGA-AR-AOTS-01A-11D-A10Y-09 BRCA c9253ecc-cfac-4cc5-8dab-1e502d34d103
TCGA-AR-AOTT-01A-31D-A099-09 BRCA 29cfdc11-2f20-436e-8913-340909684c06
TCGA-AR-AOTU-01A-31D-AlOG-09 BRCA 31922dbe-3b4a-4ac1-98fc-db88ae851462
TCGA-AR-AOTV-01A-21D-A099-09 BRCA 0ec80200-12fe-479c-8ea0-982a9995f55a
TCGA-AR-AOTW-01A-11D-A099-09 BRCA b40d49ed-bc30-4656-9f36-ffc280de2fb8
TCGA-AR-AOTX-01A-11D-A099-09 BRCA 63d635fa-d136-4e8a-a534-966ee678bb66
TCGA-AR-AOTY-01A-12W-Al2T-09 BRCA f915733b-aaf4-406d-af52-00de113e8e0c
TCGA-AR-AOTZ-01A-12D-A099-09 BRCA 90a26d5e-356b-424c-80bc-4723d24c594f
TCGA-AR-A0U0-01A-11D-A10G-09 BRCA 79e2c073-7727-4c34-ac28-5d7895144743
TCGA-AR-A0U1-01A-11D-A10Y-09 BRCA 265ceec6-e9a8-499e-adf6-0c18c598532e
TCGA-AR-A0U2-01A-11D-A10G-09 BRCA f0194733-2347-43c4-a4a3-131642c27798
TCGA-AR-A0U3-01A-11D-AlOG-09 BRCA c8251555-77d3-4a20-9cc0-f7df0fda5955
TCGA-AR-A0U4-01A-11D-A117-09 BRCA ed064e31-8fae-4f9c-8455-d7517f94e16b
TCGA-AR-A 1 AH-01A-11D-Al2B-09 BRCA ff4a0f5a-9f30-4a2b-9915-62f2df5ad155
TCGA-AR-A 1 AI-01A-11D-Al2Q-09 BRCA 842846ea-881c-4d79-88d2-fc1703c58350
TCGA-AR-A 1 AJ-01A-21D-Al2Q-09 BRCA 4e1f9084-4729-4b3f-b036-6226d64fd25b
TCGA-AR-A 1 AK-01A-21D-Al2Q-09 BRCA 52f7c22f-84cb-4263-93bf-1ae8cf8abbd2
TCGA-AR-A1AL-01A-21D-A 1 2Q-09 BRCA 8495c66e-dc95-4eae-909b-b51b8bc84889
TCGA-AR-A 1 AN-01A-11D-Al2Q-09 BRCA 9c879ced-92e8-4292-9b24-46005acab0f4
TCGA-AR-A1A0-01A-11D-Al2Q-09 BRCA b841db95-2eff-4181-8d44-3cde2f2f9e70
TCGA-AR-A1AP-01A-11D-Al2Q-09 BRCA 597e37c9-f0c9-4839-800e-6e9519ec3add
TCGA-AR-A1AQ-01A-11D-Al2Q-09 BRCA 88ff7728-ecc9-4ec5-817e-4793619ab5a4
TCGA-AR-A 1 AR-01A-3 ID-Al 5-09 BRCA 008ba655-a0a3-42c4-8c72-
f1341365ef02
TCGA-AR-A 1 AS-01A-11D-Al2Q-09 BRCA 3f26f93c-e11 a-4ec9-b73b-
98fcadc209f4
TCGA-AR-A 1 AT-01A-11D-Al2Q-09 BRCA 7e00d4fa-b951-44d8-81bf-fc7b9f19772e
TCGA-AR-A1AU-01A-11D-Al2Q-09 BRCA d7cfeb04-ce20-4aab-8e5b-8a1483bcaaa5
TCGA-AR-A 1 AV-01A-21D-Al2Q-09 BRCA 0a0dd89c-5ec8-4015-9616-733e41361a64
TCGA-AR-A1AW-01A-21D-,Al2Q-09 BRCA 33c6b6b5-1484-4002-8f84-ba67525a8777
TCGA-AR-A1AX-01A-11D-Al2Q-09 BRCA 71a3c172-3539-4ade-97d1-6a1bd1ee4205
TCGA-AR-A 1 AY-01A-21D-Al2Q-09 BRCA 15f90e10-831b-40a3-98bd-ec226a9e8b26
TCGA-AR-A24H-01A-11D-A167-09 BRCA 6bb61dce-2891-4e39-8298-df5abe8049a2
TCGA-AR-A24K-01A-11D-A167-09 BRCA df692383-1d6d-4caa-b44c-7a133ec4b7ee
TCGA-AR-A24L-01A-11D-A167-09 BRCA 2a93298a-d272-487c-ae4a-cc385844536e
TCGA-AR-A24M-01A-11D-A167-09 BRCA 722a8960-3a69-4f66-b972-74e6de94a1e8
TCGA-AR-A24N-01A-11D-A167-09 BRCA b859311c-1b29-44e3-8585-6995f9259221
TCGA-AR-A240-01A-11D-A167-09 BRCA 2c9fc77f-95 1 b-4764-911 fOeff31741b1
158

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-AR-A24P-01A-11D-A167-09 BRCA dbdcf82a-3d37-4cfb-a70b-9b69ada0e732
TCGA-AR-A240-01A-12D-A167-09 BRCA a9d69112-ad2a-4a3b-ae30-ed4af96d75f2
1CGA-AR-A24R-0 I A-I 1D-A167-09 BRCA baf43433-0001-4495-a37f-
9132eb213157
TCGA-AR-A24S-01A-11D-A167-09 BRCA aad32a56-5b98-433e-bb6e-48e09a027db6
TCGA-AR-A24T-01A-11D-A167-09 BRCA 09991de6-2e8e-476f-9876-98d9a85dac7d
TCGA-AR-A24U-01A-11D-Al 67-09 BRCA 567cdc6c-df03-4642-8cbc-a269769ce 1
al
TCGA-AR-A24V-01A-21D-A167-09 BRCA bb77af66-bb8f-4590-9be8-51729373c555
TCGA-AR-A24W-01A-I I D-A17G-09 BRCA 454e7cd4-8424-4cad-8fbb-f69affa5d I
bf
TCGA-AR-A24X-01A-11D-A167-09 BRCA 53d55f5a-df86-44d7-a3a2-2dccc2557b7b
TCGA-AR-A24Z-01A-11D-A167-09 BRCA cllf2060-d3fb-4e3d-8058-68cce44af519
TCGA-AR-A250-01A-31D-A167-09 BRCA f7d9a372-fcd1-4462-9e06-7e646ddb68fd
1CGA-AR-A251-01A-12D-A167-09 BRCA 68b4de6d-352d-44e8-911a-f4541f281c78
TCGA-AR-A252-01A-11D-A167-09 BRCA e800d9b3-32a1-48eb-8406-9a3bec9d1f6e
TCGA-AR-A254-01A-21D-A167-09 BRCA fe2bdac0-832e-4268-bd8E5defffda1979
TCGA-AR-A255-01A-11D-A167-09 BRCA 505f1398-0bd8-4f1c-a142-651605158bf3
TCGA-AR-A256-01A-11D-A167-09 BRCA ea43434b-197e-48ac-ae2e-466c7f3776de
TCGA-B6-A012-01A-11W-A050-09 BRCA a9cae7c8-a626-46ad-a98b-82e6b5fddf00
TCGA-B6-A015-01A-11W-A100-09 BRCA f1139266-fade-4d27-ac67-60870e666295
TCGA-B6-A016-01A-11D-A128-09 BRCA a876398c-5b1d-444f-a360-5fe2db697480
TCGA-B6-A018-01A-11W-A050-09 BRCA ba80b13a-e20a-441b-b845-b617cc861ce7
TCGA-B6-A019-01A-11W-A050-09 BRCA d2291482-9666-4f8f-a65b-c0737cf3acea
TCGA-B6-AOIA-01A-11W-A050-09 BRCA f7e5ada6-8f53-4765-a874-5ee9d258ad6a
TCGA-B6-A0IB-01A-11W-A050-09 BRCA ff80d5cd-7aed-499f-a472-153cc40f65de
TCGA-B 6 - AOIC ----- 11W-A050 - 09 BRCA f23fd730-0a18-4e3b-a2ed-
f1a4231c2b53
TCGA-B6-AOLE-01A-11W-A050-09 BRCA 4c639f50-5031-4b08-baa3-1a366ada6514
TCGA-B 6-AOIG-0 I A-11W-A050-09 BRCA e8046519-d928-4fd3-b3e2-
84585aa4f022
TCGA-B6-AOIH-01A-11D-A10Y-09 BRCA 4a448869-74d9-4e61-a7ef-c894c32d6942
TCGA-B6-A0U-01A-11W-A050-09 BRCA c63f9ddb-6301-400e-a0e8-197eea2efe75
TCGA-B6-AOIK-01A-12W-A071-09 BRCA c5b1f426-562e-44e4-bcce-ce2ff6d969c8
TCGA-B6-A01M-01A-11W-A050-09 BRCA e99a4753-10db-4823-953d-e878a90e6b01
TCGA-B6-A01N-01A-11W-A050-09 BRCA ee2c9198-cea3-4a54-6966-834a70c30d2f
TCGA-B6-A010-01A-11W-A050-09 BRCA 648cee86-f2e7-45a0-ab f2-0a60037e2eee
TCGA-B6-A0IP-01A-11D-A045-09 BRCA 94250f1c-d514-4dd2-b488-a93fbf111784
TCGA-B 6-AOIQ-01A-11W-A050-09 BRCA 583964cf-84ad-4ef1-90d1-2f6bfbeb245 a
TCGA-B6-AORE-01A-11W-A071-09 BRCA db2bd5cf-f0a7-4874-89e6-15029447dae 1
TCGA-B6-AORG-01A-11W-A071-09 BRCA 9431c642-
610e-4325-9768-864c5c81eacd ¨
TCGA-B6-AORH-0 I A-21D-A10Y-09 BRCA 6e59b987-b4f0-4078-af2d-482c299103b6
TCGA-B6-AORI-01A-11W-A071-09 BRCA 50d83050-b98c-4a 1 a-a673-
91dbc67c37c6
TCGA-B6-AORL-01A-11D-A099-09 BRCA 0d28966d-e036-4b2a-ba07-68f195efc296
TCGA-B6-AORM-01A-11D-A099-09 BRCA 3e03385e-f0fa-4e11-8bed-c6316802e1a9
TCGA-B6-AORN-01A-12D-A099-09 BRCA bbbcb493-2937-4a76-8454-0abbbb379927
159

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-B6-A0R0-01A-22D-A099-09 BRCA 05e12ff8-0231)-4acl-b35d-f97b42e3da7a
TCGA-B6-AORP-01A-21D-A099-09 BRCA efbdb449-13885-44bb-9054-9e97d6603cad
1CGA-B6-AORQ-01A-11D-A10Y-09 BRCA f425edf3-0d08-49bf-94f6403343873a6c
TCGA-B6-AORS-01A-11D-A099-09 BRCA 6b3ff733-402d-4390-8f57-57a9ad9b9969
TCGA-B6-AORT-01A-21D-A099-09 BRCA el a297ed-1951-4d97-978e-56b4521 1 1
ba5
TCGA-B6-AORU-01A-11D-A099-09 BRCA 251371ac-ef46-4e11-b45e-a2aaa986a2d2
TCGA-B 6-AORV-01A-11D-A099-09 BRCA 39b0b605-29ae-4e2e-81dc-319446e807dd
TCGA-B6-AOWS-01A-11D-A10Y-09 BRCA 271d1985- 1 b15-4828-8261-
4415a13048de9
TCGA-B6-AOWT-01A-11D-A10G-09 BRCA 5fb7801b-12bc-4195-8f0c-2c6e3cc36149
TCGA-B6-AOWV-01A-11D-A1 0G-09 BRCA b92107c5-c46f-4606-b4e9-2dab55ca4e9c
TCGA-B6-A0WW-01A-11D-A10G-09 BRCA e9d6f59d-7d87-4fda-ab6f-e9c2501b8600
1CGA-B6-AOWX-01A-11D-A10G-09 BRCA 47b5d831-5287-4f62-b17a-6e5eff2e4184
TCGA-B6-AOWY-01A-11D-A1 0G-09 BRCA c973a902-abdf-41a3-8250-57011dfeflf4
TCGA-B6-AOWZ-01A-11D-A100-09 BRCA f6b8b1a9-370e-4023-b8bd-934e2a3d913 a
TCGA-B6-A0X0-01A-21D-A10Y-09 BRCA 264fb6ef-65be-48fd-8216-6c493b620ad8
TCGA-B6-A0X1-01A-11D-A10G-09 BRCA a492abf9-0cd3-402c-89e2-c49d650ef540
TCGA-B6-A0X4-01A-11D-A10G-09 BRCA edbe95af-e727-4d0f-a2a4-a3c9f2afa901
TCGA-B 6-A0X5-01A-21D-Al 0G-09 BRCA da42f10b-d515-4678-a038-ed9c92a8b56b
TCGA-B6-A0X7-01A-11D-A10M-09 BRCA be5f93af-844a-4adb-ad89-05bfeefa58cd
TCGA-B6-A1KC-01B-11D-A159-09 BRCA fe3e822f-150d-47a7-a346-10919b42aa8c
TCGA-B6-AIKF-01A-11D-A13L-09 BRCA f6i6eb76-0524-4772-b918-1e8599a09d7f
TCGA-B6-AIKI-01A-11D-AFIK-09 BRCA d9374702-8fc6-48c0-bec5-5c1105e641dc
TCGA-B6-A 1 KN-01A-11D-A 1 3L-09 BRCA el ad09c8-4237-48 f0-b04c-
7ee8ccaf8c fl
TCGA-BII-A0AU-01A-11D-Al2Q-09 BRCA d0620968-8aba-44d8-b94a-990861c2324a
TCGA-BH-A0AV-01A-31D-A10Y-09 BRCA 9032b7fe-e38a-4641-a45e-67041668ade4
TCGA-BH-A0AW-01A-11W-A071-09 BRCA 82057159-dd32-49fd-9ee7-82b4668f39c3
TCGA-BH-A0AZ-01A-21D-Al2Q-09 BRCA e6d90bb8-ad96-4cb8-a96f-a8202fcbc58f
TCGA-BH-A0B0-01A-21D-A10Y-09 BRCA 4680fd93-33c8-4aee-942b-5c616acd02cf
TCGA-BH-A0B1-01A-12W-A071-09 BRCA cle20290a-1560-41fd-896b-a3ae1103423e
TCGA-BH-A0134-01A-11W-A019-09 BRCA 83bee702-eb97-4216-a47e-d4e4eece279 a
TCGA-BH-A0B5-01A-11D-,Al2Q-09 BRCA dfa0f8ea-ae94-4673-9751-f6cdad26022a
TCGA-BH-A0139-01A-11W-A071-09 BRCA c575956b-7953-4611-b0d1-3c2c40feb3b9
TCGA-BII-A0BD-01A-11W-A050-09 BRCA eba2178f-6235-49c1-a49e-98de8ffcle6a0
TCGA-BH-A0BF-01A-21D-Al2Q-09 BRCA 39221056-704b-4a23-968d-3178dd9e790d
TCGA-BH-A0BG-01A-11D-A10Y-09 BRCA 923ee16a-2c42-46ee-b2cb-82075f2dd603
TCGA-BH-A0BP-01A-11D-A10Y-09 BRCA 51405c11-e844-4316-be17-85e8adlde4a3
TCGA-BH-A0BR-01A-21W-Al2T-09 BRCA df82226e-2242-418b-9f5f-0a5e531826a4
TCGA-BH-AOBS-01A-11D-Al2Q-09 BRCA 81c4b7a4-8d94-4d31-9e08-325ee04f5f36
TCGA-BH-A013T-01A-11D-Al2Q-09 BRCA 2299036e-7099-4b53-9143-5935442c3310
TCGA-BH-A0BZ-01A-31D-Al2Q-09 BRCA 1f07765a-3f2b-4b6f-88ef-0d7aab17a753
TCGA-BH-A0C1-01B-11D-A1213-09 BRCA adebc709-8059-43c3-adOe-al 02 fal
536ff
160

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-BH-A0C3-01A-21D-Al2Q-09 BRCA ec57ee0f-949e-4eee-91c2-dd129d657065
TCGA-BH-A0C7-01B-11D-A10Y-09 BRCA ba3b30c5-8179-49bd-aacd-53326bf356f8
TCGA-BH-AODD-01A-31D-Al2Q-09 BRCA 1a59cd97-2ee8-4f82-6542-e2f35171bc01
TCGA-BH-AODG-01A-21D-Al2Q-09 BRCA ec4d4cbc-d5d1-418d-a292-cad9576624fd
TCGA-BH-AODI-01A-21D-Al2Q-09 BRCA 3777748c-5614-4826-8cde-eb7ece1b8101
TCGA-BII-A0D0-01B-11D-Al2B-09 BRCA 14649437-79 a6-40bd-87b1-a278bfb2dcda
TCGA-BH-AODS-01A-11W-A071-09 BRCA 6cfb5de9-ef59-4bc0-9ec2-f9bd5a9f2aee
TCGA-BH-AODT-01A-21D-Al2B-09 BRCA 30dbe353-86d5-40ed-84c2-dbddf7beb I
7b
TCGA-BH-A0DV-01A-21D-Al2Q-09 BRCA 24ee6b1d-3594-4d12-9163-8ad 1
b3c98f28
TCGA-BH-A0DX-01A-11D-A10Y-09 BRCA bca403d9-48ff-4534-ba33-94b8fb9fee0f
TCGA-BII-A0E2-01A-11W-A071-09 BRCA 2703ce22-3ffa-4094-b3f1-1f573b5204a9
TCGA-BH-A0E6-01A-11W-A050-09 BRCA 1c55939a-ae58-4ed9-8a6e-01bae8ac1217
TCGA-BH-A0E7-01A-11W-A050-09 BRCA 1 ddc3a98-e0b9-468e-b3d3-9d39eb7d8264
TCGA-BH-A0E9-01B-11D-A10Y-09 BRCA 48ccd30d-Oc71-4117-8ccb-013986f14e95
TCGA-BII-A0EA-01A-11D-A10Y-09 BRCA 561b8777-801a-49ed-a306-e7dafeb044b6
TCGA-BH-A0EB-01A-11W-A050-09 BRCA 3861ca01-bcc3-42a9-835d-lef9f1a053bd
TCGA-BH-AOEE-01 A-I IW-A050-09 BRCA 68d16e6a-20a5-428f-89d0-a8a0deda80cc
TCGA-BH-AOEI-01A- I ID-A 10Y-09 BRCA ee8e93e0-d08c-400e-8ed7-
ae56d7aefbec
TCGA-BH-AOGY-01A-11W-A071-09 BRCA db589949-1630-45b2-b09b-0312d3efd6Ob
TCGA-BH-AOGZ-01A-11W-A071-09 BRCA 068bd892-6fee-46c2-945f-34a6c6804070
1CGA-BH-AOH0-0 1 A-11W-A071-09 BRCA 69110467-4cf5-4b5d-a2dd-b1c91e786959
TCGA-BH-AOH3-01A-11D-Al2Q-09 BRCA 12d7dc75-2e4f-42f6-a067-fe6d7118a0b6
TCGA-BH-AOH6-01A-21W-A071-09 BRCA bbed00d2-9791-464d-alba-28fd56a0504e
TCGA-BII-AOHA-01A-11D-Al2Q-09 BRCA 95f2ee35-a485-4995-8205-01623d97da2d
TCGA-BH-AOHB-01A-11W-A071-09 BRCA ed5f1077-62c1-43d8-8a27-56521bbdd8a5
TCGA-BH-AOHI-01A-1 ID-A099-09 BRCA 507213d0-eflc-400c-8724-24cd6a39feb8
TCGA-BH-AOHL-01A-11W-A050-09 BRCA lfd I db26-79e0-4018-8548-
8fd20a96c479
TCGA-BH-AOHN-01A-11D-A099-09 BRCA ada199c5-8015-481f-a46e-46fa42646cd8
TCGA-BH-AOH0-01A-11W-A050-09 BRCA 354172e7-3e54-4ec4-88fa-fd7781cc86ae
TCGA-BH-AOHP-01A-12D-A099-09 BRCA ad52a81b-7a76-4aa0-951b-d6edab0fe2b2
TCGA-BH-AOHQ-01A-11W-A050-09 BRCA f03af67f-3119-4ee4-a4b0-227d36f493ba
TCGA-BH-AOHU-0 I A-IIW-A050-09 BRCA b46f2619-5937-4847-6638-fe6022225ab9
TCGA-BH-AOHW-01A-11W-A050-09 BRCA 706ec3be-bd65-4f42-b5cc-603f7f62c9I a
TCGA-BH-AOHX-01A-21W-A071-09 BRCA 27df78cd-1f39-42f3-92e6-56664d4c472c
TCGA-BH-AOHY-01A-11W-A071-09 BRCA a63c2000-9e41-4897-8b01-4723c382096e
1CGA-BH-AORX-01A-2 1 D-A099-09 BRCA 48115e9a-5027-455a-a88e-c3d991dbf966
TCGA-BH-A0W3-01A-11D-A1 0G-09 BRCA 3fa14183-e0c5-4dc2-bb4a-d81d42f6578b
TCGA-BH-A0W4-01A-11D-A100-09 BRCA fdafddde-aff1-4264-6f94-a95861eacf53
TCGA-BII-A0W5-01A-11D-A1 0G-09 BRCA aca1d737-c24c-49fd-86c0-ab2b29cd28de
TCGA-BH-A0W7-01A-11D-A10Y-09 BRCA 7d20774c-6aac-4eb0-a876-1be14e0t3004
TCGA-BH-AOWA-01 A- I ID-A 1 0G-09 BRCA 4076f947-alf0-4101-9a79-
79828eb3bbe3
161

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-BH-A18F-01A-11D-Al2B-09 BRCA d414b3fe-b768-4a98-b285-5284bffa6619
TCGA-BH-A18H-01A-11D-Al2B-09 BRCA d3c1b990-aac2-45f8-be28-8ccd192a0fab
TCGA-BH-A18I-01A-11D-A1213-09 BRCA f0ca4831-d56d-4bae-b304-bb43c5d2f09b
TCGA-BH-A183-01A-11D-Al2B-09 BRCA fd9923d9-2a27-432e-a0c6-4c44e6ee1f53
TCGA-BH-A18K-01A-11D-Al2B-09 BRCA 175de986-be8a-41fe-9b35-011eee3a1446
TCGA-BII-A18L-01A-32D-Al2B-09 BRCA 883cd3c9-2681-4822-8b22-29149a027514
TCGA-BH-A18M-01A-11D-Al2B-09 BRCA 0e548c1e-cbb7-4432-8112-bb262a1ef9d9
TCGA-BH-A18N-01A-1 ID-Al2B-09 BRCA 13c38ac4-c410-4602-83e3-9680b4f93839
TCGA-BH-A 1 8P-01A-11D-Al2B-09 BRCA add62423-57e9-46be-9bcc-3e53d7c2dfb7
TCGA-BH-A18Q-01A-12D-Al2B-09 BRCA a4de6680-33c3-4f6f-8696-453470a00bcb
TCGA-BII-A18R-01A-11D-Al2B-09 BRCA 42facac2-81d9-4a9f-b4f6-1de89a7662fc
TCGA-BH-A18S-01A-11D-A1213-09 BRCA a01c12fc-a33e-4a06-8b69-ebe6d4f59c2b
TCGA-BH-A18T-01A-11D-Al2B-09 BRCA 4e0ddfcb-e847-4132-bdce-aaee2e027b28
TCGA-BH-A18U-01A-21D-Al2B-09 BRCA a8400863-c145-4c6e-bcf3-e4ce4d816(.122
TCGA-BII-A18V-01A-11D-Al2B-09 BRCA 6150dd25-a8f4-4d9f-9da04956855ab67d
TCGA-BH-AlEN-01A-11D-A17G-09 BRCA cal 00ef0-be45-415f-909d-7172261d0084
TCGA-BH-A1E0-01A-11D-A135-09 BRCA 20131381-8a11-425d-8954-980e6ec7c427
TCGA-BH-AlES-01A-11D-A135-09 BRCA 7ecda44b-e942-4077-9d18-2a844ec53c9d
TCGA-BH-A1ET-01A-11D-A135-09 BRCA 9bd66613-68ad-42c1-ab43-dac1386027f9
TCGA-BH-A lEU-01A-11D-Al 35-09 BRCA dc578c75-e63c-4bdf-abfa-c2d063c9cd6d
TCGA-BH-A1LV-01A-11D-A135-09 BRCA 431be2a9-078a-4be2-b67c-b855329091f0
TCGA-BH-AlEW-01A-11D-A135-09 BRCA c6f4b1b6-a8dd-4a9a-a500-b14a738fe18f
TCGA-BH-A 1EX-01A-11D-A 1 3L-09 BRCA 53791685-0882-48ee-a38a-a05b5d1e8ba
1
TCGA-BII-A1EY-01A-11D-A13L-09 BRCA 7c035023-8ea9-4504-8103-9573745cb6ef
TCGA-BH-A1F0-01A-11D-A135-09 , BRCA , 3903b485-366d-4318-b17d-
a0194f032bd8
TCGA-BH-A1F2-01A-31D-A13L-09 BRCA a5c67494-d843-4b14-ba9c-d077396ed2dc
TCGA-BH-A1F5-01A-12D-A13L-09 BRCA 82121518-98d6-4db6-8be4-74bbe232a9ed
TCGA-BH-A1F6-01A-11D-A13L-09 BRCA 34eb095d-3d44-4c59-9ef5-94592ba97900
TCGA-BH-A1F8-01A-11D-A13L-09 BRCA 030cfc8a-7b43-4d73-8bfa-b68a47749c49
1CGA-BH-A1FC-01A-11D-A13L-09 BRCA 84c77098-03d0-4b22-atb1-797703e85c6c
TCGA-BH-A1FD-01A-11W-A14Q-09 BRCA b372b5cd-4c38-4cd3-95e0-8708ce5437e7
TCGA-BH-A 1 FE-01 A-11D-A13L-09 BRCA 5e71fe3a-a214-4899-9e1f-
8feelef29e2e
TCGA-BII-A 1FG-01A-11D-A13L-09 BRCA 311f2fla-75c8-4fee-b31d-0815d71a3173
TCGA-BH-A1FH-01A-12D-A13L-09 BRCA fd6bd486-6371-4892-863e-64838fcea624
TCGA-BH-AlFJ-01A-11D-A13L-09 BRCA dc62eafd-b5ad-42b4-9665-11ba6b22cff5
TCGA-BH-A1FL-01A-11D-A13L-09 BRCA bb84cbb1-
7244-4d92-8977-a37dbafc47b4 ¨
TCGA-BH-A1FM-01A-11D-A13L-09 BRCA 7cb17736-03da-4f77-8397-145585a25b le
TCGA-BH-A1FN-01A-11D-Al 3L-09 BRCA bf92d76c-31ff-4273-82ea-982c4c26394b
TCGA-BH-A1FR-01A-11D-A13L-09 , BRCA , a589f5ac-105c-45d6-96e1-
55e30801999c
TCGA-BH-A1FU-01A-11D-A14G-09 BRCA 9efd4b1b-d4e4-487e-8d1c-a19c2d62e3cf
TCGA-BH-A201-01A-11D-A 1 4K-09 BRCA df6e619f-67a5-49f3-9768-4826aa2e9d1b
162

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-BH-A202-01A-I ID-A 14K-09 BRCA e6feb69a-8827-4d43-94aa-036cf5150549
TCGA-BH-A203-01A-12D-A167-09 BRCA 128b9209-2201-428c-87e7-65690bfe3875
TCGA-BH-A204-01A-11D-A159-09 BRCA 2454d30f-lca5-4f01-bfce-6ae10e84e75 a
TCGA-BH-A208-01A-11D-A159-09 BRCA ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29
TCGA-BH-A209-01A-11D-A17C1-09 BRCA 4eaf8116-4733-4865-8e22-5d03887b0c9b
TCGA-BII-A28Q-01A-1 ID-Al 6D-09 BRCA 0698379c-8f4e-460d-b7da-
d3f6179dafd7
TCGA-C8-Al2K-01A-21D-A10Y-09 BRCA bcf92c27-3aa7-44-49-9c7a-fc715789788f
TCGA-C8-Al2L-01A-11D-A 10Y-09 BRCA 998a465a-d084-4d7f-8c02-8c5be1e1ee27
TCGA-C8-Al2M-01A-11D-A135-09 BRCA 9a0a7b93-da6e-45b7-9a6f-190d79552b49
TCGA-C8-Al2N-01A-11D-A10Y-09 BRCA e2af7f0c-3cf4-4ffe-b764-b4fd83bf7694
TCGA-C8-A120-01A-11D-A10Y-09 BRCA 51dbda2a-106b-4597-aa49-609b677866c8
TCGA-C8-Al2P-01A-11D-A10Y-09 BRCA 540fe594-0186-40d3-b519-ciccebe82247
TCGA-C8-Al2Q-01A-11D-A10Y-09 BRCA b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4
TCGA-C8-Al2T-01A-11D-A 10Y-09 BRCA 96Ifae8a-d944-4866-b198-ea6f I
e59a979
TCGA-C8-A 1 21J-01A-11D-A10Y-09 BRCA 444a1e19-819a-41dc-baef-
22057225efcd
TCGA-C8-Al2V-01A-11D-A10Y-09 BRCA b8728982-8254-4aa8-baa5-aaeb6d852260
TCGA-C8-Al2W-01A-11D-A10Y-09 BRCA 5fb924d9-3201-491b-90b1-fe8a6320b2d7
TCGA-C8-Al2X-01A-11D-A10Y-09 BRCA f133a2e3-73a2-40b8-855f-e819e4d11630
TCGA-C8-Al2Y-01A-11D-Al2B-09 BRCA d5c0a1 a0-3d38-497b-9f47-107f06659cbl
TCGA-C8-Al2Z-01A-11D-A10Y-09 BRCA ae68cac5-e561-4094-98fa-2303cdaa6dbb
TCGA-C8-A I 30-01A-31D-A10Y-09 BRCA da70101d-10c2-47 ab-bce1-
7757dcbb08a2
TCGA-C8-A I 31-01A-11D-A10Y-09 BRCA df8c72f3-ca4f-4a15-8d58-976d9c796570
TCGA-C8-A 1 32-01A-31D-A 10Y-09 BRCA c038ab30-af2f-4771-bf82-
dcfl9f32efab
TCGA-C8-A133-01A-32D-A 1 213-09 BRCA 641e848d-e3e2-46a7-ad42-
5e5672639816
TCGA-C8-A I 34-01A-11D-A10Y-09 BRCA a3e8738b-2456-4f08-bb3d-5debb4265f85
TCGA-C8-A I 35-01A-11D-A10Y-09 BRCA 6b47c22f-8b4e-40fd-9a12-18b539521224
TCGA-C8-A 1 37-01A-11 D-A 1 OY-09 13RCA 08778f40-d895-46f1-8e7b-
122fc598418b
TCGA-C8-A I 38-01A-11D-A10Y-09 BRCA f3474e56-8457-4f0b-8a2f-58fdd8f58607
TCGA-C8-AIHE-01A-11D-A188-09 BRCA 8314bada-5bd3-4cd2-b308-4cb2db64de94
TCGA-C8-AIIIF-01A-11D-A135-09 BRCA 508a2612-d117-44aa-b579-00a11968bcc4
TCGA-C8-A IHG-01A-1 ID-Al 35-09 BRCA ba937e3d-30b7-4446-8441-507831a4843
TCGA-C8-AIHI-01A-11D-A135-09 BRCA 75dc3bff-75da-4734-b930-al8fd3dIebfe
TCGA-C8-AIHJ-01A-11D-A13L-09 BRCA a62c3601-990f-402f-8212-ffdfde3c6df8
TCGA-C8-AIHK-01A-21D-Al3L-09 BRCA 357e0b08-fa33-4f58-92b0-d7293b63c01 d
TCGA-C8-AIHL-01A-11D-A135-09 BRCA 88c9ef88-5d85-4a4b-9c68-d9ec709 alf07
TCGA-C8-A1HM-01A-12D-A135-09 BRCA a2f9165d-9fe7-492e-9b4c-3cb4200c6e85
TCGA-C8-A IHN-01A-11D-Al 35-09 BRCA a2576147-28eb-460f-9b97-916892d801e2
TCGA-C8-A 1 HO-01A-11D-A 1 3L-09 BRCA c6fb921c-78fe-4852-b2a5-
edd5a02ae923
TCGA-C8-A26V-01A-11D-A16D-09 BRCA 6c5a83f5-983f-434c-ac29-ddb84a7f1019
TCGA-C8-A26W-01A-1 ID-Al 6D-09 BRCA d3db354e-122c-4576-a7d7-651511c11002
TCGA-C8-A26X-01A-31D-A16D-09 BRCA a5bc549a- I al f-41b4-b548-
I4c448fed6c7
163

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-C8-A26Z-01A-11D-Al 6D-09 BRCA fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c
TCGA-C8-A273-01A-11D-A16D-09 BRCA c5c6f325-5fd0-4cff-8eaf-6e23e016f605
TCGA-C8-A274-01A-11D-A16D-09 BRCA 5e6e7c20-47b3-4f0e-a3c7-8293993e39cf
TCGA-C8-A275-01A-21D-A16D-09 BRCA 7751a837-2656-4e3b-9182-556314c4f6a3
TCGA-C8-A278-01A-11D-A167-09 BRCA 7bc48524-1f69-4d85-9d16-6db7844543bd
TCGA-C8-A27A-01A-11D-A167-09 BRCA d0fd3dcc-4ac7-4fe9-9fb8-c0676b6faabb
TCGA-C8-A27B-01A-1 ID-Al 67-09 BRCA 1 le43e41-54b8-4232-b078-
5062288d3868
TCGA-D8-A13Y-01A-11D-A10Y-09 BRCA 8bb90325-028e-491a-bbaf-2cf4b3b87cd6
TCGA-D8-A13Z-01A-11D-A 1 0Y-09 BRCA c3722c97-80f5-4eea-bf50-5a214134bbcc
TCGA-D8-A140-01A-11D-A10Y-09 BRCA 795f051e-01c4-4b49-b179-bd18ba24433c
TCGA-D8-A141-01A-11D-A10Y-09 BRCA 807791d8-b6c0-4722-bf5c-d5fa30baffc6
TCGA-D8-A143-01A-11D-A10Y-09 BRCA db1763d1-icae-4a01-a0cb-3019e292aa 10
TCGA-D8-A145-01A-11D-A10Y-09 BRCA af6ca646-499a-4e0a-a194-cacf72e5810b
TCGA-D8-A146-01A-31D-A10Y-09 BRCA 9a7548dc-fc79-4ad4-a324-0e9f63c91a20
TCGA-D8-A147-01A-11D-A10Y-09 BRCA 1f292323-cafc-4e45-bb4e-f5428e1a3276
TCGA-D8-A1J9-01A-11D-A 1 3L-09 BRCA 6627e4b1-b34c-4aa2-836e-093061442a6d
TCGA-D8-A1JB-01A-11D-A 1 3L-09 BRCA 54621c54-b7ef-48e4-aa68-e2fel0bfOafb
TCGA-D8-A1JC-01A-11D-A 1 3L-09 BRCA 63a9d14f-d91a-47af-8ef6-8124193aa110
TCGA-D8-A1JD-01A-11D-A 1 3L-09 BRCA 7df92725-fa63-494d-a19d-65c6ed76e023
TCGA-D8-AlJE-01A-11D-A13L-09 BRCA bb34512b-2432-4256-968c-d7fdf38f126a
TCGA-D8-A1JF-01A-11D-A13L-09 BRCA d31358da-639c-4fe5-917c-cl7c311d2865
TCGA-D8-A1JG-01B-11D-A13L-09 BRCA 0b15c617-8e3e-48ad-a4a2-97d2ada56c44
TCGA-D8-A1M-01A-1 1 fl-Al 88-09 BRCA 9f59481d-be89-4361-8cc3-
3f1d46702016
TCGA-D8-A1JI-01A-11D-A13L-09 BRCA 2c6a885b-0452-492c-8829-13ba4b2ac455
TCGA-D8-A111-01A-31D-A14K-09 BRCA 412f96a6-6599-40a6-9dd2-afba8c643910
TCGA-D8-A1JK-01A-11D-A 1 3L-09 BRCA fadaa39d-ebd2-4887-ae54-1fca 1
2287fcf
TCGA-D8-ALTL-01A-11D-A13L-09 BRCA 425dbc9f-6bee-412a-b772-22a2724ea4c6
TCGA-D8-A1JM-01A-11D-A13L-09 BRCA f66d4178-34f3-4f5d-aa0a-7fdd03801033
TCGA-D8-AlJN-01A-11D-A 1 3L-09 BRCA c83c7d48-8671-4f27-b3dd-05411fa2f784
TCGA-D8-A1P-01A-11D-A13L-09 BRCA 1 e21a355-0cb6-4a43-b134-501f88dacf92
TCGA-D8-A1JS-01A-11D-A13L-09 BRCA 4a9181d0-d3df-4791-99f0-4db076c22a3a
TCGA-D8-AUT-01A-3 ID-Al 3L-09 BRCA 3be3972f-4125-44c3-94d6-0ddba2008fcf
TCGA-D8-A1JU-01A-11D-A 1 3L-09 BRCA 7bff4f75-749d-4a63-9a64-0bcf1cd615ea
TCGA-D8-A1X5-01A-11D-A14G-09 BRCA db4526d4-e344-4b5a-bb66-fd43b41764ca
TCGA-D8-A1X6-01A-11D-A14K-09 BRCA 1951aa38-481b-464c-9a78-0819312a0a93
1CGA-D8-A1X7-01A-11D-A14K-09 BRCA 7acb4232-db95-4889-942e-f1be897b4f2a
TCGA-D8-A1X8-01A-11D-A14K-09 BRCA 78c3c787-5731-4c38-8d7a-e5b503b11c36
TCGA-D8-Al X9-01A-12D-A159-09 BRCA b5f65c3a-b922-4a81-863d-59672b08d1bf
TCGA-D8-A1XA-01A-11D-A14G-09 BRCA a362780b-8917-4438-9693-ec9fa84c352a
TCGA-D8-A1X13-01A-11D-A14G-09 BRCA e5ca0182-61a9-4d54-adc7-385721135113
TCGA-D8-A1XC-01A-11D-A14G-09 BRCA 68fd3045-073d-4242-8a41-41b707fca625
164

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-D8-A1XF-01A-11D-A14G-09 BRCA e1587f32-2ff9-40f3-97dd-b45b0f14be46
TCGA-D8-A1XG-01A-11D-A14G-09 BRCA 80Off536-ald2-4213-685c-7780851c6378
1CGA-D8-A1X1-01A-11D-A14K-09 BRCA a371327a2-c3b0-4f62-82a2-94e9205b1d6e
TCGA-D8-A1XL-01A-11D-A14K-09 BRCA 28d44e6e-c73f-4788-8ad4-21x16572f643d
TCGA-D8-AiXM-01A-21D-A14K-09 BRCA 07418962-0a82-43a2-a66f-614903ea8380
TCGA-D8-A1X0-01A-11D-A14K-09 BRCA b5ff68a2-da74-4608-941e-dbac40153077
TCGA-D8-A1XR-01A-11D-A14K-09 BRCA 5913c81f-26ce-4f26-909e-3ed292d3c538
TCGA-D8-A1XS-01A-11D-A14K-09 BRCA 5d302c04-302e-4040-9429-37cd672e8d53
TCGA-D8-Al XT-01A-11D-A14K-09 BRCA bc13601e-3e03-4d7d-8e6e-5b05ff500ea3
TCGA-D8-A1XU-01A-11D-A14K-09 BRCA 55c547ee-7cc9-4b7a-aaca-22f2a8c8c3a4
TCGA-D8-AlXV-01A-11D-A14K-09 BRCA a76adfd1-8c89-4c13-6570-5ccc47043a70
TCGA-D8-A1XW-01A-11D-A14K-09 BRCA f29405cc-d712-4562-ac02-ca3c89fb82af
TCGA-D8-A1XY-01A-11D-A14K-09 BRCA edb6d161-8f50-4c11-8246-487c4ea9a55d
TCGA-D8-A1XZ-01A-11D-A14K-09 BRCA 381a9211-1f2b-4c14-895b-ee7fb6eb8c7f
TCGA-D8-A1Y0-01A-11D-A14K-09 BRCA 33ff7870-fa76-4e48-a223-a8e2441d8f53
TCGA-D8-A1 Y1-01A-21D-A14K-09 BRCA 2ea6e540-6e2f-48a5-99e3-27a0107d07b7
TCGA-D8-Al Y2-01A-11D-A159-09 BRCA 9dbf62eb-0de7-4410-b44b-fdf59026d8e6
TCGA-D8-A1Y3-01A-11D-A159-09 BRCA 64fa29ff-534f-4b22-b0c4-513e8657edb1
TCGA-D8-A27E-01A-11D-Al 6D-09 BRCA eab47cbb-eab0-4dd6-9cd042700e5b6227
TCGA-D8-A27F-01A-11D-Al 6D-09 BRCA fc6d77a9-121b-48ab-a899-713c3d1319a2
1CGA-D8-A27H-01A-11D-A16D-09 BRCA 78e51220-c9f8-44b2-bc1c-b34a56af3b54
TCGA-D8-A27I-01A-11D-A16D-09 BRCA 47c0db0a-fc37-4fa0-832c-e67f089d3889
TCGA-D8-A27K-01A-11D-A 1 6D-09 BRCA 09fa0bc7-acb3-4560-6687-977869c31d12
TCGA-D8-A27L-01A-11D-A 1 6D-09 BRCA 10666107-dffb-4c51-b3ee-71e70cde7c88
TCGA-D8-A27M-01A-11D-A16D-09 BRCA cb925719-ca3f-4c14-a680-6632175dd526
TCGA-D8-A27N-01A-11D-A16D-09 BRCA 6a411174-582a-4c68-bb04-5ea2e5046f7c
TCGA-D8-A27P-01A-11D-Al 6D-09 BRCA 94011b46-74e3-41c1-a3f6-6db1821d1778
TCGA-D8-A27R-01A-11D-A16D-09 BRCA 27741c13-8d5f-43b8-8651-caf69acef0e4
TCGA-D8-A27T-01A-11D-A 1 6D-09 BRCA ecabcc6a-2767-4ad8-ac4f-54cc3d081b6c
TCGA-D8-A27W-01A-11D-Al 6D-09 BRCA 6045d675-286b-4cf8-aed4-c7ff81a78919
TCGA-E2-A105-01A-11D-A10M-09 BRCA 24416e0-2016-4313-8c05-486759f5ddOf
TCGA-E2-A107-01A-11D-A10M-09 BRCA 5804fc1c-063b-429d-a652-22b0de416bd6
TCGA-E2-A108-01A-13D-A10M-09 BRCA e3e394d4-2593-4bf9-86e4-2e79d8cb8dab
TCGA-E2-A109-01A-11D-A10M-09 BRCA 3585e133-b3c1-4d90-b5f2-2b867e0ae0ec
TCGA-E2-A10A-01A-21D-A10Y-09 BRCA cd49ccc5-a776-4307-930c-298ba6cfdf79
TCGA-E2-A10B-01A-11D-A10M-09 BRCA 9d712002-74cb-459a-b350-e9a4b49aac13
TCGA-E2-A10C-01A-21D-A10M-09 BRCA 2750ed41-0bd4-4cf4-98f5-762957cf80b7
TCGA-E2-A10E-01A-11D-AlOM-09 BRCA 53007e22-e70a-46ef-a0e8-bf2ef814850a
TCGA-E2-A14N-01A-31D-Al 35-09 BRCA 00c8d151-2223-4e36-8c66-6c09e42d8777
TCGA-E2-A140-01A-31D-ANY-09 BRCA d6ab6f8d-0e65-40a3-6198-7249e4075395
TCGA-E2-A14P-01A-31D-Al2B-09 BRCA 35a96eee-113b-45cb-a999-81c13545b104
165

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-E2-A14Q-01A-1 ID-Al2B-09 BRCA ee51cf6d-351f-48f8-ab93-639c27c50e9f
TCGA-E2-A 14R-01A-11D-A10Y-09 BRCA c7212115-1007-40cf-b9b5-7b25e2f5f2a4
TCGA-E2-A14S-01A-1 1D-A 1213-09 BRCA 78f39325-eld0-4181-87f4-
cb7f00e886d7
TCGA-E2-A14T-01A-11D-A10Y-09 BRCA 14c1c6b6-575e-416b-b219-15552b62ea74
TCGA-E2-A14V-01A-11D-Al2B-09 BRCA 7033141e-bfd5-45d5-9ed5-fcdce8a191116
TCGA-E2-A14W-01A-11D-Al2B-09 BRCA fbdc8659-e9cc-483f-bd0a-1a24b5ada 1
cf
TCGA-E2-A14X-01A11D-AlOY-09 BRCA 74039 acd-5 aca-4c65-818c-
3b577d295be0
TCGA-E2-A14Z-01A-11D-A10Y-09 BRCA c83eaaca-ced5-4630-abb5-ef34db888753
TCGA-E2-A150-01A-1 1 D-A 1213-09 BRCA 446064de-ff64-4113-9080-
360e5bf6d5e4
TCGA-E2-A152-01A-11D-Al2B-09 BRCA b266b370-425c-4146-8b72-59248436618e
TCGA-E2-A154-01A-11D-A10Y-09 BRCA 336e39fb-d407-4ced-b7bb-e8ff5329abdb
TCGA-E2-A155-01A-11D-A1213-09 BRCA a966904f-e8dd-473c-8626-84c25d7e0d6c
TCGA-E2-A156-01A-11D-Al2B-09 BRCA 26003dce-0fc6-4538-a392-c80e1ebaa1e4
TCGA-E2-A159-01A-11D-A10Y-09 BRCA 757c8a2d-90cf-4dab-a4dc1-45f3cbdeaeeb
TCGA-E2-A15A-01A-11D-Al2B-09 BRCA b7e3eff1-65d5-491f-a726-35dc6752b370
TCGA-E2-A15C-01A-3 ID-Al2B-09 BRCA 10c594a1-0843-4740-9d96-00211a95091b
TCGA-E2-A15D-01A-1 ID-AMY-09 BRCA 891295d6-4dd0-4ab4-bbce-13da7f3c30d0
TCGA-E2-A15E-01A-11D-Al2B-09 BRCA c6f107df-1186-4d6d-b5b5-2393e9369dd1
TCGA-E2-A15F-01A-11D-A10Y-09 BRCA 33edf937-b09f-49ec-8f4c-e05dee7ecelf
TCGA-E2-A15G-01A-11D-Al2B-09 BRCA d45bb60a-e73b-4b95-8637-e8d17fcca745
TCGA-E2-A15H-01A-11D-Al2B-09 BRCA 7875c5b3-ced2-4669-a3d5-457396850a17
TCGA-E2-A151-01A-21D-A135-09 BRCA 9bec02b4-7cf0-4797-blac-253ef78a34af
TCGA-E2-A15J-01A-11D-Al2Q-09 BRCA e5fd7cbd-8fce-49e9-8d2c-d2a2e61367a5
TCGA-E2-A150-01A-11D-AlOY-09 BRCA 39c1df91-b670-4f6b-b5ff-dbb6b66d30af
TCGA-E2-A15P-01A-11D-A10Y-09 BRCA 5f1853c2-6579-42d0-adc2-636b5de543e4
TCGA-E2-Al5R-01A-11D-AlOY-09 BRCA 11799240-0275-48fe-84ef-85e188839bbe
TCGA-E2-A15S-01A-11D-A10Y-09 BRCA 01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd
TCGA-E2-A15T-01A-11D-A10Y-09 BRCA eff74709-36af-4da4-91c1-01100ddc7735
TCGA-E2-AIAZ-01A-11D-Al2Q-09 BRCA f961c932-cf37-47c8-8520-8d0d444dc94f
TCGA-E2-AIB0-01A-11D-Al2Q-09 BRCA 14e3b00c-cbec-4733-8fa4-82968e7d9808
TCGA-E2-A1B1-01A-21D-Al2Q-09 BRCA a6e77a14-e5e5-452e-a46f-5629ee8228e3
TCGA-E2-A1B4-01A-11D-Al2Q-09 BRCA a6aa4529-7996-4b66-9632-2559293db35d
TCGA-E2-A1B6-01A-31D-Al2Q-09 BRCA la af88fc-f7cb-4239-a420-224352194160
TCGA-E2-AIBD-01A-11D-Al2Q-09 BRCA f5ac1986-272b-48d2-9a73-4a550e38a997
TCGA-E2-AIIE-01A-11D-A188-09 BRCA e416f05b-c7d2-479b-8068-803492e86d86
TCGA-E2-A1114-01A-11D-A142-09 BRCA 7751c2d5-e548-4439-aacl-e7b9dce97583
TCGA-E2-A IIG-01A-11D-A142-09 BRCA 84da47a3-49e1-4f94-bea9-dd20b6627adb
TCGA-E2-A 1 IH-01A-11D-A188-09 BRCA cd886e35-4201-4732-90c6-142d8fe309b1
TCGA-E2-AIII-01A-11D-A142-09 BRCA 698c8a73-c6b6-45bd-82fc-9bd0f140729d
TCGA-E2-A111-01A-11D-A142-09 BRCA 3aft2da1-1647-4b95-abdb-c9db923cfc22
TCGA-E2-AIIK-01A-11D-A17G-09 BRCA 8577ac01-1274-4bd5-ab04-380eaa78d95b
166

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-E2-A IIL-01A-11D-A14G-09 BRCA 1540ae03-7bb4-418b-afbc-44bf3ad60a31
TCGA-E2-AIIN-01A-11D-A13L-09 BRCA 9c85559f-098e-4b0f-8034-4798789e710b
1CGA-E2-A110-01A-11D-A142-09 BRCA 986e9b9f-ae15-4743-a150-d6ee11f3c077
TCGA-E2-AHU-01A-11D-A14G-09 BRCA 7fcd5fda-8155-4b48-afb9-9e7958627113
TCGA-E2-A 1 L6-01A-11D-A13L-09 BRCA 1610239 f-5610-4d7b-bc31-
ae3ceb9c425d
TCGA-E2-AIL7-01A-11D-A142-09 BRCA 33a09072-6554-4d46-b738-0852624940af
TCGA-E2-AIL8-01A-11D-A13L-09 BRCA 04a7762f-2cbb-498b-ab4e-921406c1aec0
TCGA-E2-A IL9-01A-11D-A 1 3L-09 BRCA a50cd2b2-913d-41bf-94ad-
454645471)348
TCGA-E2-A 1 LA-01 A-1 1D-A142-09 BRCA bdcd4800-3258-446f-b6e5-
3c8e2f46c656
TCGA-E2-AILB-01A-11D-A142-09 BRCA 377b1816-6 1 el-431a-9952-7 1
e4d58bbd48
TCGA-E2-AILG-01A-21D-A14K-09 BRCA 7cdbe0e8-f614-4f54-b864-fd6b39e8eflc
1CGA-E2-AILH-01A-11D-A14G-09 BRCA 605f1d27-db45-449a-a68f-4888b8c786a1
TCGA-E2-AILI-01A-12D-A159-09 BRCA c812374c-8bc9-4ccf-9157-fbd9d162eele
TCGA-E2-AILK-01A-21D-A14G-09 BRCA 4e84eed6-82a8-4e91-b0fc1-61ec6ef69ce9
TCGA-E2-AILL-01A-11D-A142-09 BRCA 47312f61-5ef4-4f25-9320-8fbb4758790e
TCGA-E2-A1LS-01A-12D-A159-09 BRCA 40087f80-85f6-4cc4-95c9-0639153dd3f4
TCGA-E9-A1N3-01A-12D-A159-09 BRCA 6c3891a9-baa9-4309-9974-d82fd5f97417
TCGA-E9-AIN4-01A-11D-A14K-09 BRCA a3784a48-47a7-4587-91dd-5b8873a24ca9
TCGA-E9-A1N5-01A-11D-A14G-09 BRCA 432a9f5e-Of2a-4cd2-a910-ee9ee30c1ff3
TCGA-E9-AIN8-01A-11D-A142-09 BRCA cac57844-0e46-489b-8d94-ccea5788c050
ICGA-E9-A IN9-01A-11D-A14G-09 BRCA 2aa7aldb-40a5-421b-97ab-1031e6th7f04
TCGA-E9-AINA-01A-11D-A142-09 BRCA a3d223eb-20e6-40b9-9f07-e5f865bd2439
TCGA-E9-A1NC-01A-12W-A16L-09 BRCA 2ba4c398-b94b-49f8-bb88-9d0cb3347d2c
TCGA-E9-AIND-01A-11D-A142-09 BRCA 8e72652d-3b99-47b2-87fe-04b96b243722
TCGA-E9-AINE-01A-21D-A14K-09 BRCA dbd34322-ac40-41f0-acc7-7bfd06afdf67
TCGA-E9-AINF-01A-11D-A14G-09 BRCA cd428bec-fc31-4d2d-9e6c-c8f30608d797
TCGA-E9-AING-01A-21D-A14K-09 BRCA 1cbf389d-lec8-4543-880f-4ef64c55a44b
TCGA-E9-AINH-01A-11D-A14G-09 BRCA 13c312ec-Oadd-4758-ab8d-c193e2e08c6d
TCGA-E9-AINI-01A-11W-A16H-09 BRCA 3bf0b1694870-4887-bc06-414f20fIdcf0
1CGA-E9-AIQZ-01A-21D-A167-09 BRCA 2d47b244-e5e4-4645-91cb-71de1d685a95
TCGA-E9-A I RO-01A-22D-A16D-09 BRCA c09eaa03-c14c-4a96-a505-4d999e45270e
TCGA-E9-A 1 R2-01A-11D-A140-09 BRCA b321a2d9-5345-4891-b450-bfd696c601b0
TCGA-E9-AIR3-01A-31D-A14K-09 BRCA ba6af877-7a23-4738-a867-01a5dd8a8050
TCGA-E9-AIR4-01A-21D-A14G-09 BRCA 15d9c916-al2e-48a0-8a0f-8c240c54bd37
TCGA-E9-AIR5-01A-11D-A14K-09 BRCA a04ba6e9-2bc4-4cab-96d8-0820e0390d84
TCGA-E9-AIR6-01A-11D-A140-09 BRCA b8a1805d-a43a-4433-a90b-01715e8cc554
TCGA-E9-AIR7-01A-11D-A14K-09 BRCA b3991854-6634-4428-befl-a7d9ad9cca30
TCGA-E9-AIRA-01A-11D-A14G-09 BRCA 6d067461-2002-468e-934d-2721f6cb97ff
TCGA-E9-A I RB-01A-11D-A17G-09 BRCA 2ce0333c-deca-4199-a06c-ede43c5575fc
TCGA-E9-AIRC-01A-11D-A159-09 BRCA 5b5e7eb2-8efc-4681-ab8c 4-9a9cc4ac6d6
TCGA-E9-A1RD-01A-11D-A159-09 BRCA 2317a698-eabl-40f1-926c-c95d4ed8213d
167

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-E9-AIRE-01A-11D-A159-09 BRCA 4a9c0873-f496-48a4-853c-2b41b2dbaa9e
TCGA-E9-A1RF-01A-11D-A 1 59-09 BRCA 43983619-d863-4816-a334-445f6ca36541
TCGA-E9-AIRG-0 I A-11D-A14G-09 BRCA 81896525-0e3f-47ff-9b0d-95b45aef718c
TCGA-E9-AIRH-01A-21D-A167-09 BRCA 2ecb84c0-c307-4fa9-85e3-2f722dd365a3
TCGA-E9-AIRI-01A-11D-A167-09 BRCA 661c0074-dac9-44c6-bebc-202cfb9fb735
TCGA-E9-A226-01A-21D-A159-09 BRCA 866e5e9b-4e6c-49e2-9ea6-560f9bd99c2b
TCGA-E9-A227-01A-11D-A159-09 BRCA 15eb25c4-f4a7-446e-b654-ae39ccd2cf00
TCGA-E9-A228-01A-31D-A159-09 BRCA 4a804a8d-7dc8-4b5b-9537-b7f8f7133bda
ICGA-E9-A229-01A-31D-A17G-09 BRCA a27fa57d-dlad-4534-a933-0fdcc5f06a8c
TCGA-E9-A22A-01A-11D-A159-09 BRCA 25bf7831-6878-4bac-b23d-e94a555b2232
TCGA-E9-A22B-01A-11D-A159-09 BRCA e46a5d19-2c1c17-4c34-8fff-
6276278c58b3
TCGA-E9-A22D-01A-11D-A159-09 BRCA 3dfdc7fd-3f69-4297-a4cf-1a05b75d302f
TCGA-E9-A22E-01A-11D-A159-09 BRCA ald7dafc-a755-44a6-b45b-dc6aae309d3e
TCGA-E9-A220-01A-11D-A159-09 BRCA 2belb92a-6041-4d2b-9cf8-b9723921987f
TCGA-E9-A22H-01A-11D-A 1 59-09 BRCA 42993dbb-b99b-41148-8038-
05cfl41ec886
TCGA-E9-A243-01A-21D-A167-09 BRCA c6bb16c6-cb0f-44c6-93e7-6c55d0958f82
TCGA-E9-A244-01A-11D-A167-09 BRCA 9edf63e8-ae94-4b2f-8521-b56dadc21cd5
TCGA-E9-A245-01A-22D-A16D-09 BRCA bdd591f9-21d1-4ce5-bfde-30e7ac3d440a
TCGA-E9-A247-01A-11D-A167-09 BRCA 7c184a2b-d857-444a-936c-43e38a196df9
TCGA-E9-A248-01A-11D-A167-09 BRCA fee90b4e-f005-4b40-a9 af-dle590ble8a8
TCGA-E9-A249-01A-11D-A167-09 BRCA 2799 ad7e-d6f0-4919-b7f6-1c957b4c74f8
TCGA-E9-A24A-01A-11D-A167-09 BRCA d11d3770-a4f4-4d15-94f4-149cca27d391
TCGA-E9-A295-01A-11D-A16D-09 BRCA f3d5e986-046f-4f75-8abc-67a3b99f742d
TCGA-EW-AIIW-01A-11D-A13L-09 BRCA 8b8732c3-78b1-409b-bc8c-c482575361bb
TCGA-EW-A1IX-01A-12D-A142-09 BRCA 01ea194f-dc06-4e15-9b9e-1c73668040e0
TCGA-EW-AIIY-01A-11D-A188-09 BRCA 01d3fddf-b447-4925-a5cb-c5fd70c97278
TCGA-EW-A111-01A-11D-A188-09 BRCA 18db4143-48cc-424c-8d23-46cf23056528
TCGA-EW-A1J1-01A-11D-A188-09 BRCA 4b8151b3-8393-45d4-a73d-3c22c561d6f3
TCGA-EW-AIJ2-01A-21D-A13L-09 BRCA c906931e-cicla-434c-96cd-5808876211e7
TCGA-EW-A1J3-01A-11D-A13L-09 BRCA acl3b81a-ca05-432c-918a-Oc9c8170bf46
TCGA-EW-AIJ5-01A-11D-A13L-09 BRCA 98bb3025-0637-4106-8621-12df7b5d662f
TCGA-EW-A1J6-01A-11D-A188-09 BRCA d95c5cb1-d081-47fa-8ac0-1ade7652a0af
TCGA-EW-A10V-01A-11D-A142-09 BRCA e27ca8f5-3f76-4531-87ea-ba3a44f6830d
TCGA-EW-Al OX-01A-11D-A142-09 BRCA 7828f9cf-aa93-44a0-8070-efdf90a677f0
TCGA-EW-A10Y-01A-11D-A142-09 BRCA 925323a2-ca03-48f4-8c37-1a8a6f8a6daa
TCGA-EW-A10Z-01A-11D-A142-09 BRCA a73152be-2293-403d-940b-74ac05810808
TCGA-EW-AIP0-01A-11D-A142-09 BRCA 6475f4dd-782c-411a-b7ce-9c9ebd0753b8
TCGA-EW-A1P1-01A-31D-A14G-09 BRCA 28a56927-bab8-4a8c-bell-f46e37ea34c1
TCGA-EW-AIP3-01A-11D-A142-09 BRCA e783933d-1c24-4cd5-82b7-0d68019c3c22
TCGA-EW-A1P4-01A-21D-A142-09 BRCA 204e4et3-e6b8-469f-9024-56c6f6f07afd
TCGA-EW-AIP5-01A-11D-A142-09 BRCA 84b4da42-9673 /1448-9185-a12857ab422f
168

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-EW-AIP6-01A-11D-A142-09 BRCA eef5cea9-82f6-4001-8e2c-701e43a9787a
TCGA-EW-AIP7-01A-21D-A142-09 BRCA 402abf40-5a01-467d-a5be-b9101743f34b
1CGA-EW-A1P8-01A-11D-A142-09 BRCA e55f338f-97e2-4394-ae23-c92606069485
TCGA-EW-A1PA-01A-11D-A142-09 BRCA 56c8aca4-b3bd-4791-b05d-Ob2338b6346d
TCGA-EW-A1PB-01A-11D-A142-09 BRCA 9ddf2119-a222-4fa5-a9f3-09ec7eeea36b
TCGA-EW-AIPD-01A-11D-A142-09 BRCA 5a288561-bf14-4cb9-b2f5-9ece0e038319
TCGA-EW-AIPE-01A-11D-A142-09 BRCA 54377bac-8f52-4116-b7e5-b71a8a721ac4
TCGA-EW-A1PG-01A-11D-A142-09 BRCA bd3801e2-c5bb-4116-9ce3-97903fc6956e
TCGA-EW-A 1 PH-01A-11D-A 1 4K-09 BRCA ce860c6f-c87a-4a45-92df-
ca34bfh2e8b2
TCGA-GI-A2C8-01A-11D-A16D-09 BRCA 535a899d-67ca-4500-8dda-63a331a3611c
TCGA-AA-3664-01A-01W-0900-09 COAD 9cff122a-9960-4f2e-ba5b-94736bad7f2b
TCGA-AA-3566-01A-02W-0900-09 COAD d7065ea5-88b0-4b56-a367-5defa0d9ed27
TCGA-AA 3667 01A 01W 0900 09 COAD c2799cdc-c6f7-44ba-a72c-e1632b434575
TCGA-AA-3672-01A-01W-0900-09 COAD 04dc0b16-834c-4351-b3b9-58fe558c634d
TCGA-AA 3673 01A 01W 0900 09 COAD 79521001-8901-44b4-833e-824282967118
TCGA-AA-3678-01A-01W-0900-09 COAD 968fea30-df40-425f-87ba-935942dbd450
TCGA-AA-3679-01A-02W-0900-09 COAD 94cfbc05-df22-4db0-9aa0-808faabOlc61
TCGA-AA-3680-01A-01W-0900-09 COAD 20dd1d44-2321-4a84-b8b9-894073c6acd3
TCGA-AA-3681-01A-01W-0900-09 COAD e5fea94c-f2ab-4476-b641-f2764eb0d026
TCGA-AA-3684-01A-02W-0900-09 COAD 6ecc0812-6ce3-4569-9868-6c4936236682
TCGA-AA 3585 01A 02W 0900 09 COAD db8d5d6c-c200-4ffc-albb-8465044cefad
TCGA-AA 3688 01A 01W 0900 09 COAD 7224118e-b762-4e72-8bee-9e87c37aac7f
TCGA-AA-3692-01A-01W-0900-09 COAD 6e2f4d01-6413-473e-98f4-9256ca4285d5
TCGA-AA-3693-01A-01W-0900-09 COAD 45ea6cb9-8d5e-4470-bd07-a2c59ddc5cf0
TCGA-AA-3695-01A-01W-0900-09 COAD db143a45-b2c5-4dce-98d4-d15decc5b757
TCGA-AA 3696 01A 01W 0900 09 COAD 9e1f1824-12e2-42be-aa57-e0d0b4079a4c
TCGA-AA 3715 01A 01W 0900 09 COAD 554258ce-99c3-49a3-bfbf-131ec867a0e9
TCGA-AA-3812-01A-01W-0900-09 COAD 28087364-af53-4ac4-b1b2-bbe54b71c040
TCGA-AA-3814-01A-01W-0900-09 COAD 733e8b21-718b-405d-b860-ed36c70a8411
TCGA-AA 3818 01A 01W 0900 09 COAD 9ddb06a8-300e-40d2-8t6a-c851e2190d90
TCGA-AA 3819 01A 01W 0900 09 COAD 0192a572-a235-400d-8fb 1 -
af81e40d3763
TCGA-AA-3831-01A-01W-0900-09 COAD 7843d5c1-373d-4a55-82b8-db218ead890c
TCGA-AA-3833-01A-01W-0900-09 COAD 9ea5c555-6e44-4313-8572-779a099efaaa
TCGA-AA-3837-01A-01W-0900-09 COAD 888c1825-a44b-49cb-bed1-09db01e54b75
TCGA-AA 3848 01A 01W 0900 09 COAD 729fbad4-0152-44e5-b26b-dffc1f7dcf70
1CGA-AA-3852-01A-01W-0900-09 COAD leelab0a-cd8c-49d5-ab8c-0d2a2194724t
TCGA-AA 3854 01A 01W 0900 09 COAD 2a7ecd84-d49c-484c-a918-381769835ebc
TCGA-AA-3856-01A-01W-0900-09 COAD 7a07d137-7936-486d-aeb5-6d9598fe4660
TCGA-AA-3858-01A-01W-0900-09 COAD 99e41f17-b760-4b34-8230-39aa42db46fd
1CGA-AA-3860-01A-02W-0900-09 COAD 57869735-96td-4439-ba2d-583dt6tc32a0
TCGA-AA 3875 01A 01W 0900 09 COAD 06e6b2e8-634e-4b03-989e-0d192b60b64a
169

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-AA-3966-01A-01W-1073-09 COAD 689f1a40-4315-489c-8b05-75d800e17b44
TCGA-AA-3994-01A-01W-1073-09 COAD 4348f66a-c104-4fdd-bdee-2f346832835d
1CGA-AA-A004-01A-01W-A00E-09 COAD Ob856311-aa63-44b7-a191-9d6d8308c3d0
TCGA-AA-A00N-01A-02W-A00E-09 COAD dfb1aec9-d196-49e6-bdb1-9318222b8121
TCGA-AA-A000-01A-02W-A00E-09 COAD 0328eea5-c89c-4462-8af8-48a28ed38537
TCGA-AA-A010-01A-01W-A00E-09 COAD 77cdcb19-16fa-4330-921c-e21f17c2298e
TCGA-AA-A017-01A-01W-A00E-09 COAD a0ad6347-d20c-494a-a094-b816c4fec5de
TCGA-AA-A01D-01A-01W-A00E-09 COAD e00404 be-Obea-4893-89cf-cc24073flOb
1
1CGA-AA-A011-01A-02W-ACOE-09 COAD ee78a7e5-6ddb-4d06-81b1-ba7300af59e1
TCGA-AA-A01K-01A-01W-A00E-09 COAD 7b7c405e-65c8-4633-ac54-0a112fb478ac
TCGA-AA-A024-01A-02W-A00E-09 COAD 45a6b8e2-a4a7-400e-ba7a-f93c29f50fe4
TCGA-AA-A029-01A-01W-A00E-09 COAD 41be5565-479e-4c56-b48b-1de52dad2299
TCGA-AA-A02F-01A-01W-A00E-09 COAD 68c4226b-dfbd-4130-b50e-94839bcb lbOf
TCGA-AA-A02H-01A-01W-A00E-09 COAD 1cbf3771-fb49-4517-83ba-8e112fcbld00
TCGA-AA-A02:1-01A-01W-A00E-09 COAD 5d03450f-b249-4dcd-927b-713158acc8b 2
TCGA-AA-A02W-01A-01W-A00E-09 COAD 2104138f-b09d-4452-91e1-c4a10382f009
TCGA-AY-4070-01A-01W-1073-09 COAD a7a74785-31cf-4527-bac2-991d7df97b5f
TCGA-AY-4071-01A-01W-1073-09 COAD 80aa3f17-b072-4e59-a6fc-1afe016fa477
TCGA-02 0003 01A OlD 1490 08 GBM 458f13e0-34f3-4a92-b3b3-9a3c2ee3ef23
TCGA-02 0033 01A OlD 1490 08 GBM 39d1f122-31d0-4e1c-95a7-0e65e75b 1457
TCGA-02-0047-01A-01D-1490-08 OHM ce03026e-b756-43 a2-972d-b 3
a4dcda5491
TCGA-02 0055 01A OlD 1490 08 GBM 9cd89af4-5118-4adb-aald-fbd03bf42a33
TCGA-02-2470-01A-01D-1494-08 GBM 0b35f2ff-2a08-4585-ala9-cfc6a9f5b224
TCGA-02-2483-01A-01D-1494-08 OHM 4d7f2c74-862b-4aad-98e1-fa831f14a905
TCGA-02-2485-01A-01D-1494-08 GBM 0332b017-17d5-4083-8fc4-9d6f8fdbbbde
TCGA-02 2486 01A OlD 1494 08 GBM 3331813c-f538-4833-b5eb-a214b7d52334
TCGA-06 0119 01A 08D 1490 08 OHM 0cda6181-c62b-4ced-a543-d6138fd2e94a
TCGA-06 0122 01A OlD 1490 08 GBM 08c54819-32fa-455d-a443-fc71 dfd3 f03
a
TCGA-06-0124-01A-01D-1490-08 GBM 6ac82bf8-7076-43fb-a541-4c7db5d49280
TCGA-06-0125-02A-11D-2280-08 GBM 96e3db14-2bb1-4f68-aed6-5e794750c96e
TCGA-06 0126 01A OlD 1490 08 GBM c3c3059d-e2fb-45ea-80b5-99fb040cba29
TCGA-06 0128 01A OlD 1490 08 GBM c5688535-bda4-4831-aaba-e0c19101d7b0
TCGA-06 0129 01A OlD 1490 08 GBM 73e7aa35-91b4-4392-bbb9-9ec21f30250c
TCGA-06 0130 01A OlD 1490 08 OHM c09f0ebd-d604-49a3-9738-0c65fd471b19
TCGA-06-0132-01A-02D-1491-08 GBM 53c2e159-5774-499f-bOdl-e04fa3faf5c 3
TCGA-06-0137-01A-01D-1490-08 OHM 37c11c1fc-c37c-4cb6-bd81-9e0a7789b0f1
TCGA-06 0139 01A OlD 1490 08 GBM c84ff17d-436d-49c1-aef2-b998ffe4a693
TCGA-06 0140 01A OlD 1490 08 GBM 18c94086-d2cc-45cd-9bad-f8968a042d5e
TCGA-06 0141 01A OlD 1490 08 OHM 5af251d5-e76b-480c-8142-6d6fbfce0b2a
TCGA-06 0142 01A OlD 1490 08 GBM 4bce79ce-c59c-4d86-b25f-28c8edda1651
170

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-06-0145-01A-01W-0224-08 GBM 8f904068-2967-4938-8813-3ad0a99e4af8
TCGA-06 0151 01A OlD 1491 08 GBM 5fea9ebc-8c1b-4078-af87-79c7f5b5470b
1CGA-06-0152-01A-02W-0323-08 OHM 79062efd-2b09-4798-a504-0a18ca30ef2d
TCGA-06 0154 01A 03D 1491 08 GBM f5045707-3ddd-4ade-959a-b368437752fb
TCGA-06-0155-01B-01D-1492-08 GBM 2dc59e9b-3a60-4178-9fa0-81cf5171622d
TCGA-06-0157-01A-01D-1491-08 GBM ble62d8e-24d2-4118-gcd0-3142acebdd5b
TCGA-06 0158 01A OlD 1491 08 GBM 14580533-4a0c-47ca-bb51-c233700de35c
TCGA-06 0165 01A OlD 1491 08 GBM 1728988e-0877-4194-92c5-92c1ee6c5f5b
1CGA-06 0166 01A OlD 1491 08 OHM 70157018-a3c5-4ef8-9314-f8715a3438a4
TCGA-06 0167 01A OlD 1491 08 GBM d530c696-235d-4a41-944d-e7f7ae21aa 17
TCGA-06 0168 01A OlD 1491 08 GBM 2b3bab1e-cald-4c2c-95ec-7bb6e700e070
TCGA-06 0169 01A OlD 1490 08 GBM 06053a14-2d9a-4df0-a79b-81bda36bf3c3
TCGA-06-0171-02A-11D-2280-08 GBM 39520be3-a2af-4189-acf4-9d239363333a
TCGA-06 0173 01A OlD 1491 08 GBM 0908aac1-d3b7-4eec-96f2-a28c3738388c
TCGA-06-0174-01A-01D-1491-08 OHM 017c9167-0354-41e4-ad504b38fcb5668c
TCGA-06 0178 01A OlD 1491 08 GBM a4fa779b-d116-4696-b170-60f3e215e9fb
TCGA-06 0184 01A OlD 1491 08 GBM a5a2e50f-dc7e-44cc-bffe-b675a707bf53
TCGA-06 0185 01A 01W 0254 08 OHM bc62d57d-b536-41ab-a344-e765fd3f7439
TCGA-06-0188-01A-01W-0254-08 GBM cc0c78e7-1476-45e6-b043-dc209bb9a32a
TCGA-06 0189 01A OlD 1491 08 GBM 25c64c53-746c-4e92-976a-8bc19471b9c7f
TCGA-06 0190 02A OlD 2280 08 GBM c065761d-f775-457f-bda0-4c7c257a7O1e
TCGA-06-0192-01B-01W-0348-08 GBM 43d7bc6f-be9b-4d5e-bcec-4tb30b0d9b65
TCGA-06 0195 01B OlD 1491 08 GBM 2a2fac52-44aa-41f7-ae27-de6b7eba8ff1
TCGA-06-0209-01A-01D-1491-08 OHM b4a7de67-14b6-4b8c-abbe-9eaa990d905e
TCGA-06 0210 02A OlD 2280 08 GBM b60392fb-43d9-4c9c-b91b-ded40492e61c
TCGA-06-0211-02A-02D-2280-08 GBM 3914c02e-44ad-4c96-8464-61aa95b42c49
TCGA-06-0213401A-01D-1491-08 OHM 88519d1-7-fc27-43c2-9acc-833c410b2db1
TCGA-06-0214-01A-02D-1491-08 GBM 08ac57ec-0036-4134-a99b-f22eaa27abOd
TCGA-06 0216 01B OlD 1492 08 GBM eac73a02-b2e0-4601-9b16-aceb07594fe8
TCGA-06 0219 01A OlD 1491 08 GBM a6c6c454-058f-41ec-93c3-3cff44bed149
TCGA-06-0221-02A-11D-2280-08 GBM b2d17671-d2e1-4c97-8b01-a976d5abeld6
TCGA-06-0237-01A-02D-1491-08 GBM a50b5271-484a-436e-ac6f-6074071015fd
TCGA-06-0238-01A-02D-1492-08 OHM 7e8c6b9f-Ofec-49ea-9ecb-c9ba1fb4cb74
TCGA-06 0240 01A 03D 1491 08 GBM 20f74001-lcb8-451d-8173-5795fa93432b
TCGA-06-0241-01A-02D-1491-08 GBM 4dd4035a-c800-41b0-85c9-02531d2910ed
1CGA-06-0644-01A-02D-1492-08 OHM 2553c4d2-516a-4eba-84b6-04c4761ebf5c
TCGA-06-0645-01A-01D-1492-08 GBM 3f458a3c-baac-427d-b346-6f15104a8886
TCGA-06-0646-01A-01D-1492-08 OHM 8974295d-0256-48c7-8d8f-41b6e5e50561
TCGA-06-0648-01A-01W-0323-08 GBM 33f8304e-11c3-4a9d-ad21-ffea555309dc
TCGA-06 0649 0113 01W 0348 08 OHM 27a16a5f-993d-41t0-a9at-65e5a8cc4144
TCGA-06-0650-01A-02D-1696-08 GBM 89af56db-b7f9-41d2-af62-c9b2ee7b540f
171

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-06 0686 01A 01W 0348 08 GBM 4af220fa-c00b-40b1-ae82-b2c256a3d3fe
TCGA-06-0743-01A-01D-1492-08 GBM 430e6ca1-d678-4373-8d8d-9d93412c8012
1CGA-06 0744 01A 01W 0348 08 OHM d80afd62-48a6-4da4-8026-e6384e86cf62
TCGA-06 0745 01A 01W 0348 08 GBM 188c837e-6389-48eb-8677-91c8a2f099ac
TCGA-06-0747-01A-01W-0348-08 OHM 7773738f-f5dd-48ae-870c-aa89aea77450
TCGA-06 0749 01A 01W 0348 08 GBM 1121aced-04ae-4ba2-a467-c5b8445a0a76
TCGA-06 0750 01A 01W 0348 08 GBM fc15ced3-5ed1-4f88-8789-09ec713bd613
TCGA-06 0875 01A 01W 0424 08 GBM 862cc896-a0dc-4f02-9940-8c9a50160276
TCGA-06-0876-01A-01W-0424-08 OHM c2f27319-4e84-41,12-bce1-623ea20722be
TCGA-06-0877-01A-01W-0424-08 GBM dda2b842-fd80-4d14-9aa5-3cd3a0c0a0e1
TCGA-06-0878-01A-01W-0424-08 GBM 07869e29-9ced-4be5-9a6c-8fd3c29ae487
TCGA-06 0879 01A 01W 0424 08 OHM f9668966-e0c2-441)6-63f6-e76d7953d537
TCGA-06-0881-01A-02W-0424-08 GBM 1069a9d0-9978-4c01-8516-947200264314
TCGA-06-0882-01A-01W-0424-08 GBM 385a3692-3208-479f-9f39-37f665501b80
TCGA-06 1804 01A OlD 1696 08 GBM d9a1ff46-8d28-451e-937f-bdad42bddd64
TCGA-06-1806-01A-02D-1845-08 GBM beb40d7c-3861-4efe-9b1d-34ba68a66c9d
TCGA-06-2557-01A-01D-1494-08 GBM c27290e4-6835-448a-abdc-df8ddd5f4630
TCGA-06 2558 01A OlD 1494 08 GBM 19f41e2f-cff9-4f04-ba65-6d945bf05edd
TCGA-06-2559-01A-01D-1494-08 GBM 8df55600-9f8f-4636-bdb2-1af8b45df1ba
TCGA-06-2561-01A-02D-1494-08 GBM f9898ad3-f9b6-4061-90ef-30e0eab0a706
TCGA-06-2562-01A-01D-1494-08 OHM 6c63467e-0ad8-4dd9-869b-9103629fd16f
TCGA-06-2563-01A-01D-1494-08 GBM 1d81086c-bf8b-4459-abcf-1ff905c6bf74
TCGA-06-2564-01A-01D-1494-08 OHM 9225 f366-b089-4c43-a09 f-al6b3bcfb5aa
TCGA-06 2565 01A OlD 1494 08 GBM c866726d-2d95-4d23-b3d4-0e28a0b3da00
TCGA-06-2567-01A-01D-1494-08 GBM d40a4861-b8c4-4f68-815a-4e8280leedca
TCGA-06-2569-01A-01D-1494-08 GBM 617eec0b-78e9-4663-946c-cO1e7e00a7de
TCGA-06-2570-01A-01D-1495-08 OHM 04339769-517c-448d-a7ca-951f83608c60
TCGA-06-5408-01A-01D-1696-08 GBM ed8ca267-0153-475b-9154-361af62ff767
TCGA-06 5410 01A OlD 1696 08 GBM 67244284-dc40-46cb-a2ac-3f4a38f7bbe4
1CGA-06 5411 01A OlD 1696 08 OHM 2fdab641-d736-4f9a-aa4c-c1944f131a69
TCGA-06 5412 01A OlD 1696 08 GBM b6be0866-68ae-4767-8cdc-e1dd4f78f440
TCGA-06-5413-01A-01D-1696-08 OHM 72c13e51-Odd2-4e96-af37-aa4714074361'
TCGA-06 5414 01A OlD 1486 08 GBM 7aa16ff4-169a-4206-83d1-a2495fb56f62
TCGA-06 5415 01A OlD 1486 08 GBM fca08ee9-b480-4dc7-be56-f1eb03b56f7c
TCGA-06 5417 01A OlD 1486 08 OHM 66350d36-6662-4d4c-9cf8-e052a17cddba
TCOA-06-5418-01A-01D-1486-08 OHM ae28fd78-
d254-46fa-aba1-1353931aa414 ¨
TCGA-06-5856-01A-01D-1696-08 GBM 0bd9b573-712b-4da1-9c33-7b7f43d4af31
TCGA-06 5858 01A OlD 1696 08 GBM 951799e6-12f0-4cf6-8732-f2e044db7210
TCGA-06 5859 01A OlD 1696 08 OHM bb404507-ab63-4d82-99c643297bffc46t
TCGA-06-6388-01A-12D-1845-08 OHM c9214f86-6684-4e29-812c-2a44963e8914
TCGA-06-6389-01A-11D-1696-08 OHM 10911471-5404-42d5-817e-f9616e7dacfc
172

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-06 6390 01A 11D 1696 08 GBM f04b6bde-63e0-41c9-89f7-07673f9de0f6
TCGA-06 6391 01A 11D 1696 08 GBM 40fc77dc-46df-4487-925f-1d87c5326661
TCGA-06-6693-01A-11D-1845-08 OHM 45ca8f53-6d0e-4659-a81f-258184b7a70e
TCGA-06-6694-01A-12D-1845-08 GBM b5a5717d-Oe3d-4944-82f3-5968187beb52
TCGA-06-6695-01A-11D-1845-08 OHM 13817acd-8c 1 e-4154-8988-7cdc5f2660a7
TCGA-06 6697 01A 11D 1845 08 GBM 7d947ed1-1315-459e-b973-f3dd624d9e39
TCGA-06 6698 01A 11D 1845 08 GBM d605a279-c0ea-467c-a423-cdf21547f87e
TCGA-06-6699-01A-11D-1845-08 GBM 90ba858d-e399-40d8-98ee-eeb127c58409
TCGA-06-6700-01A-12D-1845-08 OHM 6da42a38-94dd-4997-8a03-df0f7174ca6f
TCGA-06-6701-01A-11D-1845-08 GBM fad178f1-3859-4f94-bd29-567c1aa0a8fc
TCGA-08-0386-01A-01D-1492-08 GBM 909f7f8f-4b8c-410f-afa6-2b439ec82f97
TCGA-12-0615-01A-01D-1492-08 OHM a6068793-51e4-4762-9150-cdtb030e8ade
TCGA-12-0616-01A-01D-1492-08 GBM b0e2fed7-38bd-48d8-a786-ae574c9fa5be
TCGA-12-0618-01A-01D-1492-08 GBM 3909c5e9-787e-4a3f-86c8-e3e0e7e43824
TCGA-12 0619 01A OlD 1492 08 GBM 79c65ab5-1924-4710-96e4-31e9a615a53e
TCGA-12-0688-01A-02D-1492-08 GBM 143dc738-1694-4105-8115-9cc0902ef35b
TCGA-12-0692-01A-01W-0348-08 GBM 937fb2a6-3856-4086-a327-8d8e593b7b7b
TCGA-12-0821-01A-01W-0424-08 GBM 357e3a3c-ceeb-4b38-be35-6fe8f5be5ac8
TCGA-12 1597 01B OlD 1495 08 GBM 7d35c610-cc06-4aa5-8c96-2f7b7465069f
TCGA-12-3649-01A-01D-1495-08 GBM 2580567a-8f51-4cb7-9525-bba987c55e36
TCGA-12-3650-01A-01D-1495-08 OHM 8b1d52e2-4899-4972-9bef-1690ccd2bac9
TCGA-12 3652 01A OlD 1495 08 GBM ab4609e2-e504-497f-8533-ab06448a55bc
TOGA-12-3653-01A-01D-1495-08 OHM fdc52d48-828e-481f-balc-0264f1da38a5
TCGA-12 5295 01A OlD 1486 08 GBM 796f5741-3b2d-46e5-974f-e5a76604a401
TCGA-12-5299-01A-02D-1486-08 GBM a449541c-49f2-489a-8593-7de98963e4f8
TCGA-12 5301 01A OlD 1486 08 GBM 891fe6bc-d0a7-4064-842c-43d500b4ef5d
TCGA-14 0740 01B OlD 1845 08 OHM f49859c4-adf9-4c53-8288-8a7ad65a940d
TCGA-14 0781 01B OlD 1696 08 GBM 13878ec6-fce7-423e-b545-6656145e9d2c
TCGA-14 0786 01B OlD 1492 08 GBM 75fa4de1-29fd-4954-963a-add459f1d69c
TCGA-14-0787-01A-01W-0424-08 OHM 1849240c-ebt1-4ecf-87eb-aae0718cd8lf
TCGA-14-0789-01A-01W-0424-08 GBM 3462087f-f791-4394-b9d9-911cc48eaf9e
TCGA-14 0790 01B OlD 1494 08 OHM d63d49a0-9413-4583-a7a5-cb2c202cc085
TCGA-14-0813-01A-01W-0424-08 GBM 754cd19e-a319-4ddf-887b-ddca4914cdf9
TCGA-14-0817-01A-01W-0424-08 GBM a5f06dfc-e9b2-46a6-bee5-604d2839baad
TCGA-14-0862-01B-01D-1845-08 OHM f0b7d451-8190-45a4-8242-9f698f05243d
TCCIA-14-0871-01A-01W-0424-08 OHM Oce45f48-
0967-42dc-8035-e76c60d0a3fd ¨
TCGA-14 1034 02B OlD 2280 08 GBM 7cae6c09-36fe-411b-bbba-093a4c846d84
TCGA-14 1043 01B 11D 1845 08 GBM a439c422-8728-42f5-8dda-6e9e1590478c
TCGA-14 1395 0113 11D 1845 08 OHM 882597a5-dtae-4e21-94ec-05161131341e9
TCGA-14-1450-01B-01D-1845-08 OHM 7ee7f174-13f6-44b1-83e3-6f35a244f00e
TOGA-14-1456-01B-01D-1494-08 OHM e525e774-1925-41cd-9822-15aeeee29190
173

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-14 1823 01A 01W 0643 08 GBM 1c3ddf6a-e496-4687-8339-084d814b6876
TCGA-14 1825 01A 01W 0643 08 GBM f0d7cb8b-995c-419b-a366-aadb156879bc
TCGA-14-1829-01A-01W-0643-08 OHM c69ca476-9e11-4f6e-a4f5-6952f792a580
TCGA-14 2554 01A OlD 1494 08 GBM 53dec97d-0464-4ffd-8e2e-9562b9a03af0
TCGA-15-0742-01A-01W-0348-08 OHM 3c015456-02f0-4473-9e25-b53166da41ea
TCGA-15-1414-01A-02D-1696-08 GBM cbd4d4e7-f1c4-446c-8dbc-ce06c872ec14
TCGA-16-0846-01A-01W-0424-08 GBM cf3eb226-36c2-4498-a5c1-3f161de6fa3f
TCGA-16 0861 01A 01W 0424 08 GBM deab6efd-8213-4f35-a897-060c605ce58b
TCGA-16-1045-0113-01W-0611-08 OHM c92c1d87-0df9-4c5a-b aef-2dd26ad6d75 a
TCGA-19-1390-01A-01D-1495-08 GBM d7e8e408-0a8f-4177-ad38-08c51a484ed0
TCGA-19 2619 01A OlD 1495 08 GBM b765a4c7-4fe8-444c-95bd-6a4d03af1432
TCGA-19-2620-01A-01D-1495-08 OHM 6de4lac1-2296-4069-a494-5588c284351d
TCGA-19-2623-01A-01D-1495-08 GBM al4ae5c3-fee0-4ed7-9080-51056ce62ef2
TCGA-19 2624 01A OlD 1495 08 GBM a8f86664-914c-4d89-897b-33bcdd1759f7
TCGA-19-2625-01A-01D-1495-08 GBM b0833912-0cb6-4d2a-bd18-9fc211793b30
TCGA-19-2629-01A-01D-1495-08 GBM 56ffaa35-814c-4c0b-b3c6-d4514d34fec2
TCGA-19 5947 01A 11D 1696 08 GBM d5e7dd90-ead0-40fe-94c5-bc740cb509ab
TCGA-19 5950 01A 11D 1696 08 GBM 8d6626e2-ea32-4b ld-8f2b-389294121692
TCGA-19 5951 01A 11D 1696 08 GBM 57cf584c-8c95-42ec-9cb0-707228b70010
TCGA-19 5952 01A 11D 1696 08 GBM 483cad63-ca73-4b31-b4c7-9d73f2cb4186
TCGA-19-5953-0113-12D-1845-08 OHM a0180465-3685-4735-a76e-acbeebfa635a
TCGA-19 5954 01A 11D 1696 08 GBM cfd4e06e-203f-4a6f-8aa9-60828e0d4d68
TCGA-19-5955-01A-11D-1696-08 OHM c8abde95-f4d7-4d48-879b-bd584eaf8a25
TCGA-19 5958 01A 11D 1696 08 GBM fd385a8e-d6dc-4e65-a023-ce485793c410
TCGA-19 5959 01A 11D 1696 08 GBM dd3e4733-7154-4162-9a61-a3a685e5f561
TCGA-19 5960 01A 11D 1696 08 GBM b8151614-b08f-49a3-ab6f-2e780f765a17
TCGA-26 1442 01A OlD 1696 08 OHM 17e25583-886e-4dc9-802b-35e67971073c1
TCGA-26-5132-01A-01D-1486-08 GBM d1132127-1250-43af-9c16-425798a3d1a7
TCGA-26 5133 01A OlD 1486 08 GBM 533051f3-5ea5-41a4-8727-11dc6d786607
TCGA-26 5134 01A OlD 1486 08 OHM 11956d98-46a5-486f-ae79-05aacebe0631
TCGA-26 5135 01A OlD 1486 08 GBM 2ce48101-2f61-49d9-a56a-7438bf4a37d7
TCGA-26 5136 01B OlD 1486 08 GBM 39e05876-1b04-4c68-8ae4-3ae7781e8017
TCGA-26-5139-01A-01D-1486-08 OHM 8199001b-a3c9-47e1-97cf-943fa8030f46
TCGA-26-6173-01A-11D-1845-08 GBM af373e42-cbbf-4a89-8479-bdd413011885
TCGA-26-6174-01A-21D-1845-08 GBM 3ba04f15-48f4-4851-a21f-8fa7cc9eac6b
TCGA-27 1830 01A 01W 0643 08 OHM 6391392a-9865-46f4-b5fl-fa4fb2ad1343
TCGA-27 1831 01A OlD 1494 08 GBM 9880c3c9-5685-42a7-8fe9-7585ea1a1d37
TCGA-27-1832-01A-01W-0643-08 OHM 7ea7ee22-55a6-4748-9607-d93a6a367122
TCGA-27 1833 01A 01W 0643 08 GBM 4d8d34d9-7069-436c-84d6-ace5760c2aec
TCGA-27 1834 01A 01W 0643 08 OHM a6c0824e-3d2a-498a-a177-44ea96ba5ce4
TCGA-27-1835-01A-01D-1494-08 GBM 6d5fd73b-4cad-44ae-8c79-67f2b9d30328
174

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-27 1836 01A OlD 1494 08 GBM 8c58f090-31a3-462f-93e7-1ae6f6d73350
TCGA-27 1837 01A OlD 1494 08 GBM 61 adl d55-21 a9-49c4 -9256-54
a24703afda
TCGA-27 1838 01A OlD 1494 08 OHM 881af1d2-31bc-44dd-8362-e6c386345cf6
TCGA-27 2518 01A OlD 1494 08 GBM dae099ff-330f-492b-a06d-6f975e9e5aea
TCGA-27-2519-01A-01D-1494-08 OHM bOdaafab-b783-4cfc-9f7d-8017d98e8Obb
TCGA-27 2521 01A OlD 1494 08 GBM 3678d5f3-9a29-4750-b0a9-20e971ff6aa4
TCGA-27-2523-01A-01D-1494-08 GBM d60f54f5-b154-42c4-99fb-cea4e7a33dc7
TCGA-27-2524-01A-01D-1494-08 GBM ce679bfd-fbf9-4c78-822e-37d2322d5446
TCGA-27-2526-01A-01D-1494-08 OHM bclabcb7-b4e9-4447-90c5-Ofc09401eec0
TCGA-27-2527-01A-01D-1494-08 GBM b8b00995-ada6-493b-bafc-0f6c9def41c9
TCGA-27-2528-01A-01D-1494-08 GBM 374cbd87-428e-4509-85c1-b7d3302c30a0
TCGA-28 1747 01C OlD 1494 08 GBM 7c746081-ac14-4ae2-9564-d67d52f2627c
TCGA-28 1753 01A OlD 1494 08 GBM c7143f1e-458c-4129-aa91-61b8e4990e53
TCGA-28 2499 01A OlD 1494 08 GBM 28583f40-c3fc-4213-91c1-99d7d536551e
TCGA-28-2501-01A-01D-1696-08 GBM 2a2c625d-4069-4824-b09d-2d49634ed284
TCGA-28-2502-01B-01D-1494-08 GBM 707466c8-138a-4ed0-b806-6579464595cb
TCGA-28-2509-01A-01D-1494-08 OHM f4a62fe0-cee2-487a-9a8a-4cd98d8380df
TCGA-28-2510-01A-01D-1696-08 OHM 5f2dc303-9859-4b63-8aab-c387da4b2cc1
TCGA-28-2513-01A-01D-1494-08 GBM 52d1150e-abd7-4fd2-abe9-09428c5a610c
TCGA-28-2514-01A-02D-1494-08 GBM 6eef4a0e-3fef-4529-8193-21b380d96344
TCGA-28-5204-01A-01D-1486-08 OHM e9590ee4-92d8-4a1b-908e-Oc816d2b82f3
TCGA-28 5207 01A OlD 1486 08 GBM 2d795a16-bdc3-44f0-8c01-6eeec0e1 a0b1
TCGA-28-5208-01A-01D-1486-08 OHM 76209124-93 f0-4992-892c-e268abdefe2b
TCGA-28 5209 01A OlD 1486 08 GBM ef8663f3-b820-46ac-a99c-3d401a6203d7
TCGA-28 5211 01C 11D 1845 08 GBM f8dc8466-1617-4699-9dc5-3f79e21ece94
TCGA-28-5213-01A-01D-1486-08 OHM 6866e742-5ed0-4d7d-b96c-52f8f6f37142
TCGA-28 5214 01A OlD 1486 08 GBM c992e603-30c9-4e30-a425-8050189db4f8
TCGA-28 5215 01A OlD 1486 08 GBM 34c77b5d-c3a6-4e83-96f4-fadd729362d9
TCGA-28 5216 01A OlD 1486 08 GBM cde8518a-ce8e-4654-ab21-5ad4171ab1b3
TCGA-28-5218-01A-01D-1486-08 OHM 68008a98-3889-4dd2-bcf9-f1f6cbca6355
TCGA-28-5219-01A-01D-1486-08 GBM f016e9f7-66a3-4f50-b9cd-58b1c8a955e9
TCGA-28-5220-01A-01D-1486-08 OHM f7b80486-fa19-49c7-8ace-ea61338677d7
TCGA-28 6450 01A 11D 1696 08 GBM 5f10d0c5-0568-44b9-98ce-bbea41820850
TCGA-32 1970 01A OlD 1494 08 GBM 65723119-bdfe-46f0-6629-c171023abd71
TCGA-32 1979 01A OlD 1696 08 OHM 0c81ebb9-20a6-40c1-96e2-17b99517e988
TCGA-32 1980 01A OlD 1696 08 OHM 96267205-1994-46ff-8d0f-56625dae7c 1 b
TCGA-32 1982 01A OlD 1494 08 GBM 9cf7c4cb-ce19-4679-9163-b74369603e22
TCGA-32 1986 01A OlD 1494 08 GBM 5afe3ffc-ba3a-49bb-9837-091b600c6b35
TCGA-32 2615 01A OlD 1495 08 GBM 65e3c804-b 1 a3-4e21 -9407-
90a6edc4e290
175

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-32 2632 01A OlD 1495 08 GBM 27203e18-af27-478c-a224-8bca77a81c90
TCGA-32 2634 01A OlD 1495 08 GBM 52132a114-4f8c-4c02-af9d-24c4a05d4ca0
TCGA-32-2638-01A-01D-1495-08 OHM 1e103221-ab46-4a5c-9696-5e34f0d49fc2
TCGA-32 5222 01A OlD 1486 08 GBM f48abf4d-flfb-486f-97a1-0c3843566af7
TCGA-41-2571-01A-01D-1495-08 OHM 36349a22-176-48d8-9669-1921ee7576ff
TCGA-41 2573 01A OlD 1495 08 GBM fadc9e2a-d97d-4e86-a814-4f32f8cfd7a5
TCGA-41-2575-01A-01D-1495-08 GBM 4943e80a-d098-49cd-8261-1d53d42f8223
TCGA-41-3392-01A-01D-1495-08 GBM c081337a5-9938-4a60-8183-d73bOlcb9a89
TCGA-41-5651-01A-01D-1696-08 OHM 5fd776a9-5015-4d89-86a0-582e5c76bdd6
TCGA-41-6646-01A-11D-1845-08 GBM 6272bb0c-c47b-4cd2-9f59-398f1a75f020
TCGA-74-6573-01A-12D-1845-08 GBM 0941e50e-1205-49ed-8735-1f86eaf87718
TCGA-74 6575 01A 11D 1845 08 OHM f4ec96d6-d7fc-4892-9a36-80802f387a12
TCGA-74-6577-01A-11D-1845-08 GBM 513e142d5-66f7-4ele-ae75-4963026332a2
TCGA-74 6578 01A 11D 1845 08 GBM a2ae2128-4d95-4261-a30d-bd6be58de8e0
TCGA-74-6584-01A-11D-1845-08 GBM cedd2d49-371b-4b12-8aac-6a9bd38f2ccb
TCGA-76-4925-01A-01D-1486-08 GBM ca2fa3da-18d6-4e8b-8081-607022ead6a8
TCGA-76-4926-01B-01D-1486-08 GBM 3c93658-d39b-4a5e-907a-865438630d21
1CGA-76-4927-01A-01D-1486-08 OHM 2dc69425-dbid-4228-ab78-541062b5c445
TCGA-76 4928 01B OlD 1486 08 GBM 6e30f277-875e-4ab8-bc7c-0a5121cde6d1
TCGA-76 4929 01A OlD 1486 08 GBM af4f8b89-837a-48b7-b0e7-12aec23fc285
TCGA-76 4931 01A OlD 1486 08 GBM d4a27742-ca69-4f54-9bce-ec33d8481fed
TCGA-76-4932-01A-01D-1486-08 GBM 81656daa-af7c-430c-afa3-0eb 10eb9a695
TCGA-76 4934 01A OlD 1486 08 GBM e9bc4701-562e-4d35-a949-53a61fd96651
TCGA-76-4935-01A-01D-1486-08 OHM c8d06abf-437d-46c9-8046-44345af74f36
TCGA-76-6191-01A-12D-1696-08 GBM 4dbf66ef-4108-4a86-a8eb-6ba8cdefb4a2
TCGA-76 6192 01A 11D 1696 08 GBM c29754bc-44e8-4980-98a1-b8d69700f4a3
TCGA-76-6193-01A-I11)-16964)8 OHM 6a751d65-5fcf-4c03-8253-8f I b8faccab2
TCGA-76-6280-01A-21D-1845-08 GBM 9096e339-7730-4d7a-acab-a6c4d26c52c3
TCGA-76-6282-01A-11D-1696-08 GBM 1c7f63c12-a2a4-42c3-928b-319695a66443
TCGA-76 6283 01A 11D 1845 08 GBM a4083f8b-0c39-4d65-a372-b494ca184f8d
TCGA-76-6285-01A-11D-1696-08 GBM 28380a2f-d302-451b-a4c5-31b2fd150bc3
TCGA-76-6286-01A-11D-1845-08 GBM 45d03116-6cff-4074-9c26-2e5f1a8854d3
TCGA-76-6656-01A-11D-1845-08 OHM fe66f11a-e03d-49c5-befe-db74ef55ce61
TCGA-76-6657-01A-11D-1845-08 GBM 6ba47878-126c-420d-b3c1-ca7ea8c182d0
TCGA-76 6660 01A 11D 1845 08 GBM f4960945-c464-49c2-8ad6-d73a6fa47b20
1CGA-76 6661 0113 11D 1845 08 OHM 8329c910-7ccf-4e84-6468-bd6cf23327a2
TCGA-76 6662 01A 11D 1845 08 GBM 7f7c8Oca-6ad9-4820-83ca-524863873eea
TCGA-76-6663-01A-11D-1845-08 OHM 624864ad-3178-4a6d-a0cf-7fa3e9bdf8da
TCGA-76-6664-01A-11D-1845-08 GBM 6a8f17c6-060d-492e-8a39-53d9ac7035a4
TCGA-81 5910 01A 11D 1696 08 OHM bcf79a66-30e6-4554-982e-38d8eab46114
TCGA-81-5911-01A-12D-1845-08 GBM a501e01b-249c-43cb-aee24355c3c697dd
176

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-87 5896 01A OlD 1696 08 GBM 640c33a6-a7df-4dba-9c21-367a9a839f0f
TCGA-BA-4074-01A-01D-1434-08 HNSC 2c84c904-0cbc-4645-07c5-94ec45e61268
TCGA-BA 4075 01A OlD 1434 08 HNSC 5b3fec35-d127-4cb5-859b-edac003acdf3
TCGA-BA 4076 01A OlD 1434 08 HNSC 93dda6a6-907d-4dc2-9391-36dd090767c6
TCGA-BA-4077-01B-01D-1434-08 HNSC 9b37211a-2150-4d33-bc6a-9d6a0a429708
TCGA-BA-4078-01A-01D-1434-08 IINSC f02d0332-d7c8-4d2a-98ca-dbe7826437ae
TCGA-BA-5149-01A-01D-1512-08 HNSC 6e98841c-ce33-4b7e-882d-ce65707d4c10
TCGA-BA 5151 01A OlD 1434 08 HNSC dac15d7e-3930-4fcb-b752-4a4f00449ddd
TCGA-BA-5152-01A-02D-1870-08 HNSC 18da68fd-3140-45a3-ba28-4c9055504e68
TCGA-BA-5153-01A-01D-1434-08 HNSC 363ccc6f-dab0-413e-bc42-d738ee25abcd
TCGA-BA-5555-01A-01D-1512-08 IINSC 65dc1531-713b-41ba-a567-caa12340c0cf
1CGA-BA-5556-01A-01D-1512-08 HNSC d31fda32-3630-44e4-8f2c-834a66f46b87
TCGA-BA-5557-01A-01D-1512-08 HNSC 7caa2a2f-3b77-46f0-9886-37f6e4278d83
TCGA-BA-5558-01A-01D-1512-08 HNSC 97a47fa4-c857-4483-9572-07012c10e9d5
TCGA-BA 5559 01A OlD 1512 08 IINSC c0845927-fc9a-41b2-9431-619952878e18
TCGA-BA-6868-01B-12D-1912-08 HNSC 51647474-f538-4e96-babd-e742f11b793f
TCGA-BA 6869 01A 11D 1870 08 HNSC b78a2501-f312-41a2-ab19-7c18d8df0ac6
TCGA-BA 6870 01A 11D 1870 08 HNSC 2fdd3f42-cb2f-4faf-8a47-b8bfee058265
TCGA-BA 6871 01A 11D 1870 08 HNSC a8a04117-0ebc-4c27-83d6-441be47e5fd3
TCGA-BA-6872-01A-11D-1870-08 HNSC 18202a39-4881-402a-a907-b51aa114584a
TCGA-BA 6873 01A 11D 1870 08 HNSC f656842c-257e-4ac7-a155-23d3ac12d41c
TCGA-BA-7269-01A-11D-2012-08 HNSC 2e8ffdfc-48f5-41e0-9192-d76113b518ef
TCGA-BB-4217-01A-11D-2078-08 HNSC 5916ef19-7838-4621-a869-de8c2b34931c
TCGA-BB-4223-01A-01D-1434-08 IINSC c4799ee4-3014-4b2f-ba7e-9771ab5dc3f1
TCGA-BB-4224-01A-01D-1434-08 HNSC cfa7d658-031d-4cd4-9ca3-ceaa201f702d
TCGA-BB-4225-01A-01D-1434-08 HNSC 85fb5611-0dee-4a73-8aal-1629ad929173
TCGA-BB-4227-01A-01D-1870-08 HNSC clb315bb-7730-4fd0-88ec-d11044996adc
TCGA-BB-4228-01A-01D-1434-08 HNSC 6fd93146-1026-4362-982b-dlfc70e3c65d
TCGA-BB-7861-01A-11D-2229-08 HNSC 77cb5c69415e-45de-a060-0e8b52648209
1CGA-BB-7862-01A-21D-2229-08 HNSC 84c57a23-1428-488e-9275-9t2bc3673476
TCGA-BB-7863-01A-11D-2229-08 HNSC 0bf356d5-1259-4042-9860-2093f5fe32c
TCGA-BB-7864-01A-11D-2229-08 HNSC 1d6324a3-81)94-45d1-8993-134ffcaOlaec
TCGA-BB-7866-01A-11D-2229-08 IINSC 8d6ae619-033e-453c-aa6d-dda14cd5a337
TCGA-BB-7870-01A-11D-2229-08 HNSC d584f4ec-09b0-40fe-bba2-256b6cf6974e
TCGA-BB-7871-01A-11D-2229-08 HNSC 8e13f8a5-5d80-4e34-bffa-54ae808114e7
TCGA-BB-7872-01A-11D-2229-08 HNSC cO5cb0b5-
0288-48f0-bdc0-ee9acd6643a8 ¨
TCGA-CN-4723-01A-01D-1434-08 HNSC d5d71c48-1a2d-4d7d-8f2c-e3a68352776b
TCGA-CN-4725-01A-01D-1434-08 HNSC 57ffef9d-193b-48f6-8d50-3c2cca854d93
TCGA-CN-4726-01A-01D-1434-08 HNSC 2201e681-a727-4td2-adec-cbcb54302232
TCGA-CN-4727-01A-01D-1434-08 HNSC b24fc60a-fe83-4743-a6d3-d90b807412e1
TCGA-CN-4728-01A-01D-1434-08 HNSC e450fec8-66dd-4798-8197-420698ba7c4d
177

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-CN-4729-01A-01D-1434-08 HNSC 7240e742-9315-4fb8-b6f7-28bfe69410a8
TCGA-CN-4730-01A-01D-1434-08 HNSC 543bbfe3-4a11-49af-b445-303f0912bfc3
TCGA-CN 4731 01A OlD 1434 08 HNSC 31ffd2d8-ee97-4002-9737-08c044878ace
TCGA-CN-4733-01A-02D-1870-08 HNSC 12880a34-83d1-4075-b62a-9fc61d18ca09
TCGA-CN-4734-01A-01D-1434-08 HNSC 1d54bb fa-62a2-4d8b-88 fb-b74b9le 1
b958
TCGA-CN-4735-01A-01D-1434-08 IINSC 369ebd14-ee27-414d-978d-3698711fae98
TCGA-CN-4736-01A-01D-1434-08 HNSC 788337f5-722c-45d6-8ca4-8037c489cb64
TCGA-CN 4737 01A OlD 1434 08 HNSC 4c6857bb-f20f-4ac9-9c2c-cb83c5387a74
TCGA-CN-4738-01A-02D-1512-08 HNSC 1d3b16fd-1980-45ef-a423-861975609806
TCGA-CN-4739-01A-02D-1512-08 HNSC 7d6cc6ef-6bb0-44ab-bacl-c8f7198d1d8a
TCGA-CN-4740-01A-01D-1434-08 IINSC 40308868-8d79-484b-85a4-257142763d72
TCGA-CN 4741 01A OlD 1434 08 HNSC 3486c689-d7ae-4ce8-8df5-ac8271b4661d
TCGA-CN-4742-01A-02D-1512-08 HNSC lfa89bda-b719-445a-85d2-76ce8c484b15
TCGA-CN-5355-01A-01D-1434-08 HNSC 0d93e8bc-69d5-47aa-040b-0f700acle92d6
TCGA-CN 5356 01A OlD 1434 08 IINSC aad13fa4-b2e7-4c89-9936-57cf7a5e16a4
TCGA-CN-5358-01A-01D-1512-08 HNSC 498c0blf-678f-4170-b0dl-aad89bfa2a23
TCGA-CN 5359 01A OlD 1434 08 HNSC dcfle53d-22dc-4b11-9b3f-e421bc280835
TCGA-CN-5360-01A-01D-1434-08 HNSC 174flea8-abcf-44ee-b17b-9687b3ab6dae
TCGA-CN 5361 01A OlD 1434 08 HNSC 5eea0205-e539-48de-b94c-4b068c74ec96
TCGA-CN-5363-01A-01D-1434-08 HNSC 203f8426-6e,c5-427a-9ccf-ec2b4683504d
1CGA-CN 5364 01A OlD 1434 08 HNSC 22078e53-2c9e-4ae4-a166-344881259ee8
TCGA-CN 5365 01A OlD 1434 08 HNSC a419a54c-5804-4682-aaca-ed85697dd2a0
TCGA-CN-5366-01A-01D-1434-08 HNSC 161342fd-4cfa-4fc8-9708-71+815b137c6
TCGA-CN-5367-01A-01D-1434-08 IINSC 57adb398-48c5-4a14-a43e-f79a19befbda
TCGA-CN-5369-01A-01D-1434-08 HNSC 4c8e6937-9fd7-41cc-ac74-d8b75235d4b3
TCGA-CN-5370-01A-01D-2012-08 HNSC f4ca6755-68ca-4702-b08b-65005d31e9be
TCGA-CN 5373 01A OlD 1434 08 HNSC 00988676-1e9b-4e00-b4aa-a8f86c21b206
TCGA-CN-5374-01A-01D-1434-08 HNSC 28d5a97b-3f3d-4595-9034-8491999fcf40
TCGA-CN-6010-01A-11D-1683-08 HNSC 2d9693f3-0917-42be-97b8-4dc15cc4d3f6
TCGA-CN 6011 01A 11D 1683 08 HNSC 0e0aa5da-2cb2-47b8-b000-83a07d68ed29
TCGA-CN 6012 01A 11D 1683 08 HNSC c5d99faa-ef68-4f08-af97-d722bcc383f5
TCGA-CN-6013-01A-11D-1683-08 HNSC 992de905-c394-48e7-04e3-4c4aeac04a23
TCGA-CN-6016-01A-11D-1683-08 IINSC fcb6e29c-864d-483f-a848-8a61202d9516
TCGA-CN-6017-01A-11D-1683-08 HNSC 7cd89cbe-6bd9-41a2-a042-345fa0a09866
TCGA-CN 6018 01A 11D 1683 08 HNSC 33815edd-bb4f-4f05-bc82-94eafe423652
TCGA-CN-6019-01A-11D-1683-08 HNSC 00769a89-
ffc5-46f5-a42e-25b3eae886c2 ¨
TCGA-CN-6020-01A-11D-1683-08 HNSC 1f33c4c7-4f08-44a2-91f5-7ed2d7da68f0
TCGA-CN-6021-01A-11D-1683-08 HNSC e62a2c4d-18e3-4ec8-8d93-40e055e65be4
TCGA-CN-6022-01A-21D-1683-08 HNSC 90cd2296-7133-4cbe-99cb-84b084e688cd
TCGA-CN-6023-01A-11D-1683-08 HNSC d0308f96-c932-4a0f-b50844elb50739ee
TCGA-CN-6024-01A-11D-1683-08 HNSC 0604584e-0654-4b00-94fc-45e76588000c
178

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-CN-6988-01A-11D-1912-08 HNSC 230b06a8-5f6e-41db-bb59-19e4e6c9afaf
TCGA-CN-6989-01A-11D-1912-08 HNSC 61cd2198-d85e-4eae-b9c6-e36be372595b
TCGA-CN-6992-01A-11D-1912-08 HNSC 7a70356c-74a3-40c3-bd32-3049da642831
TCGA-CN 6994 01A 11D 1912 08 HNSC 1571)67 ad-f092-4ea3-b557-
0406839e6905
TCGA-CN-6995-01A-31D-2012-08 HNSC c0b6813d-4b3e-479e-81a7-1e5c2de89b0d
TCGA-CN-6996-01A-11D-1912-08 I INSC c063bec5-c716-4ea2-843a-
e9f0bec3b540
TCGA-CN-6997-01A-11D-2012-08 HNSC 11b53 1 cc-d9d9-496a-8448-
e6546a71c414
TCGA-CN-6998-01A-23D-2012-08 HNSC 9c364f7e-5690-44ef-9f80-250e428989ef
TCGA-CQ-5323-01A-01D-1683-08 HNSC 892067ef-c465-46ea-8f91-10636dd008 lb
TCGA-CQ-5324-01A-01D-1683-08 HNSC 67b184fe-c4f4-49f3-938e-5370eb6246b9
TCGA-CQ-5325-01A-01D-1683-08 I INSC 22b6ab15-aad8-46ab-9687-e3c12309659
TCGA-CQ-5326-01A-01D-1870-08 HNSC 19924919-808d-4565-6666-82724f6 I
edaa
TCGA-CQ-5327-01A-01D-1683-08 HNSC da19d7bc-9748-4cd4-bd54-479289483810
TCGA-CQ-5329-01A-01D-1683-08 HNSC 5aa9b6fc-4169-4346-981b-4c711d08c1701
TCGA-CQ 5330 01A OID 1683 08 I INSC 4ce7e702-9b62-459e-b264-
a26cabba3a93
TCGA-CQ-5331-01A-02D-1870-08 HNSC d2c2d3db-dbc0-44f1-b625-17f3f819c122
TCGA-CQ-5332-01A-01D-1683-08 HNSC 4fdf4f0d-0a55-465e-8545-65f1aad37c10
TCGA-CQ-5334-01A-01D-1683-08 HNSC 39978192-2119-4910-a2f6-53834a2b1bf2
TCGA-CQ-6218-01A-11D-1912-08 HNSC d3717097-7cdb-446f-a020-78c770362656
TCGA-CQ-6219-01A-11D-1912-08 HNSC c6263b94-Offe-40e7-9184-deb427c67802
TCGA-CQ-6220-01A-11D-1912-08 HNSC 65e67eda-16a4-4dfd-94a9-546c76d94a02
TCGA-CQ-6221-01A-11D-2078-08 HNSC d6166f0d-c0b5-44a3-814d-0c94c5bc4160
TCGA-CQ-6222-01A-11D-1912-08 HNSC de2c492f-5cd8-4330-a5de-36f693ee3laf
TCGA-CQ-6223-01A-11D-1912-08 I INSC be7cb5b4-1d09-479c-8bf2-
a9e7abde575f
TCGA-CQ-6224-01A-11D-1912-08 HNSC c03d51a0-8731-430d-a792-280e01629e8f
TCGA-CQ-6225-0IA- I ID-1912-08 HNSC cd311590-3c69-4ff2-8fbd-cb5b0f21975e
TCGA-CQ-6227-01A-11D-1912-08 HNSC ca62509e-d477-41ca-9bc2-3f20c2dd4e49
TCGA-CQ-6228-01A-11D-1912-08 HNSC 655e5026-1a6e-4eab-a948-4120d6c31c29
TCGA-CQ-6229-01A-11D-1912-08 HNSC 07e76152-9e83-42a5-9111-c39a2310a2e4
TCGA-CQ-7065-01A-11D-2078-08 HNSC 64c422bb-a531-4636-8e68-bdaf212df6dc
TCGA-CQ-7067-01A-11D-2229-08 HNSC 01f46aa2-el5b-4544-add5-c783868b6c26
TCGA-CQ-7068-0IA- I ID-2078-08 HNSC 97a96e61-f2dc-4af4-807a-3925c1ffbf43
TCGA-CR-5243-01A-01D-1512-08 HNSC 297e8b35-5686-4d56-6812-861651949a20
TCGA-CR-5247-01A-01D-2012-08 HNSC 3b5b0764-29ef-4a55-b6ab-93352613f631
TCGA-CR-5248-01A-01D-2012-08 HNSC e5af63d7-e8b2-4a76-8b39-6ee652ad8e5f
TCGA-CR-5249-01A-01D-1512-08 HNSC 42bf9ca3-47d8-45ff-bccf-bda80af58d22
TCGA-CR-5250-01A-01D-1512-08 HNSC 49e54f5a-9b3a-47ff-b6cc-aleaf54fd136
TCGA-CR-6467-01A-11D-1870-08 HNSC 2a7f5a16-9330-45a1-9024-1cfn cdb5714
TCGA-CR-6470-01A-11D-1870-08 I INSC 30bc4d1e-f0cb-44c5-a32c-
b4b690cd6cc5
TCGA-CR 6471 01A 11D 1870 08 HNSC c087e871-867c-45dd-8645-5ab774e4827c
TCGA-CR-6472-0 I A-I ID-1870-08 HNSC 52f I2c71-2473-4411-aad6-
318a3496e82c
179

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-CR-6473-01A-11D-1870-08 HNSC 9f3396a0-a38d-4069-b65 a-c4c4dd6187
ad
TCGA-CR-6474-01A-11D-1870-08 HNSC 6b4369e1-cf03-4a40-9a66-fc67bfb946b3
1CGA-CR 6477 01A 1 ID 1870 08 HNSC e02f3646-a500-4781-ad44-2f62661a883d
TCGA-CR 6478 01A 11D 1870 08 HNSC c21f40c6-4260-4def-8cca- 1
c11895635b0
TCGA-CR-6480-01A-11D-1870-08 HNSC 7ee5501e-5463-4481-b798-3d23bfb41113
TCGA-CR-6481-01A-11D-1870-08 I INSC 5e7d2531-81c1-48bb-9c0a-1867d I
f83f92
TCGA-CR-6482-01A-11D-1870-08 HNSC 684bcd80-30fb-49e5-b72a-09502a9d1468
TCGA-CR 6484 01A I ID 1870 08 HNSC e72df726-1575-4789-afac-3b15a7643401
TCGA-CR 6487 01A 11D 1870 08 HNSC d4df06d7-97e1-4f22-83a7-993fdcd3a4da
TCGA-CR-6488-01A-12D-2078-08 HNSC 8bfa9606-b24d-4803-b551-2e86fb02ae5e
TCGA-CR-6491-01A-11D-1870-08 I INSC a32853ad-b6a3-4147-ae5a-
f48fad71581e
TCGA-CR-6492-0 I A-12D-2078-08 HNSC d4550d39-4f32-48ab-b049-2fe623332d07
TCGA-CR 6493 01A 11D 1870 08 HNSC f061 abfa-4554-4328-9e8f-b84dd2aa4b45
TCGA-CR-7364-01A-11D-2012-08 HNSC f5047f1e-5088-4d30-927d-e64147fe661d
TCGA-CR-7365-01A-1 ID-2012-08 I INSC ec I14413-a950-4e74-abc8-98857af8b9
ad
TCGA-CR-7367-01A-11D-2012-08 HNSC b82e34db-7b0e-4bbd-bc42-ba063ac42409
TCGA-CR-7368-01A-I ID-2129-08 HNSC 4b194ab3-d213-4a7a-be46-909b4f0c7291
TCGA-CR-7369-0 I A-IID-2129-08 HNSC fl 6a5c08-c9f8-442e-ba13-
45681cacda40
TCGA-CR-7370-0 I A-I ID-2129-08 HNSC 9f8ec337-85f7-4b01-a2b6-
5db9a9e62f30
TCGA-CR-7371-01A-11D-2012-08 HNSC 68201be8-a 1 a9-4c78-ad99-
3c767ca8366b
TCGA-CR-7372-01A-11D-2012-08 HNSC 9032c525-9bed-47f9-b9f2-ecce4593ea37
TCGA-CR-7373-01A-11D-2012-08 HNSC 9b1f5f6d-503c-4933-944a-b4fd I
cc3fa93
TCGA-CR-7374-01A-11D-2012-08 HNSC 2cf33b63-464e-49a0-88f0-6a6d5b0393e4
TCGA-CR-7376-01A-11D-2129-08 I INSC a6b11f68-79da-4542-818d-
f404116c0bf8
TCGA-CR-7377-01A-11D-2012-08 HNSC 93e4eb9a-7643-411b-be90-94b801f23566
TCGA-CR-7379-01A-I ID-2012-08 HNSC 8cc45c0I-a363-4151-9ea0-32c404b79da4
TCGA-CR-7380-01A-11D-2012-08 HNSC ac968fdd-970b-41fc-99f7-5670c741bc06
TCGA-CR-7382-01A-11D-2129-08 HNSC fdde6828-b9f4-4648-a86b-157c5d46abb2
TCGA-CR-7383-01A-11D-2129-08 HNSC 203629ed-2791-4e22-a9da-be647b0cdef5
TCGA-CR-7385-01A-11D-2012-08 HNSC 2c00b622-c4a4-4862-b14a-a97b7261f461
TCGA-CR-7386-0 I A-IID-2012-08 HNSC dac99486-00bc-41ad-92b4-8bed1a286122
TCGA-CR-7388-01A-11D-2012-08 HNSC 3eddb2ad-6c75-4ae7-9d27-8ec0e7b4aa55
TCGA-CR-7389-01A-11D-2012-08 I INSC 37149937-8131-4dbf-916b-
d599d203eba7
TCGA-CR-7390-01A-11D-2012-08 HNSC 714399 af-e425-43bb-a82a-b62ca6fd735d
TCGA-CR-7391-01A-11D-2012-08 HNSC 7236609c-34dd-425a-b882-2dff36983f7b
TCGA-CR-7392-0 I A-1 ID-2012-08 HNSC 0616d3e5-
9641-4329-a65a-19f4c6918e1c ¨
TCGA-CR-7393-01A-11D-2012-08 HNSC f59ef1d2-2fc0-44a0-9d2f-c4efd9e79f5d
TCGA-CR-7394-01A-11D-2012-08 HNSC 1 fe9a612-4c9a-432d-b175-el
d8bdbc7c56
TCGA-CR-7395-0 I A-11D-2012-08 HNSC bdOb 1b16-ee20-48e5-bel 1-
70eac9c15630
TCGA-CR-7397-01A-1 ID-2012-08 HNSC 693863e2-4657-4ca2-8fce-094fe5df163a
TCGA-CR-7398-01A-11D-2012-08 HNSC 12c391de-3138-4e73-bde7-b06512dd0fa7
180

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-CR-7399-01A-11D-2012-08 HNSC 0a76ba15-f6e5-484f-8a52-9be8351ebd67
TCGA-CR-7401-01A-11D-2012-08 HNSC f8d6968c-2648-4dcf-a0da-77e46878581c
1CGA-CR-7402-01A-11D-2012-08 HNSC 015b1cc4-6fa5-43c1-9444-4alat766317e
TCGA-CR-7404-01A-11D-2129-08 HNSC 1c1a8920-9163-4d56-a982-61c4e792cee7
TCGA-CV-5430-01A-02D-1683-08 HNSC 4dfcbe35-9e78-4629-8a00-96fee7062d1e
TCGA-CV 5431 01A OlD 1512 08 IINSC fl a234f0-8890-4cf3-891f-c7a7423b 1
e75
TCGA-CV-5432-01A-02D-1683-08 HNSC 91e9ac70-5524-4b13-9d53-7cec52b38ea5
TCGA-CV 5434 01A OlD 1683 08 HNSC 69ef7b45-cd0e-4d59-a0ee-35a8c830120c
TCGA-CV-5435-01A-01D-1683-08 HNSC ec0a71911-3c3a-4797-9ec5-90d3474da727
TCGA-CV 5436 01A OlD 1512 08 HNSC 34dc613e-e414-4897-ac4b-13ff46e46d7e
TCGA-CV 5439 01A OlD 1683 08 IINSC 42a06486-b084-4497-8fe0-a8cff194e020
TCGA-CV-5440-01A-01D-1512-08 HNSC 5f5ba5a9-8089-4fe7-92e3-6c31c5fb32d4
TCGA-CV-5441-01A-01D-1512-08 HNSC f5712873-a4ae-4fc0-9d4c-e1f4ef47482e
TCGA-CV 5442 01A OlD 1512 08 HNSC 4d42594f-c1f4-45ed-8bd2-77011914d33c
TCGA-CV 5443 01A OlD 1512 08 IINSC 9d279797-4464-4ef5-8858-640978ccc258
TCGA-CV-5444-01A-02D-1512-08 HNSC c1975479-131b-4b37-927e-cacb1f13e62d
TCGA-CV 5966 01A 11D 1683 08 HNSC 24ad5336-f5ee-49c0-a176-48411285fbe8
TCGA-CV-5970-01A-11D-1683-08 HNSC a52dc15f-d06d-46ed-a73e-aa004a2a736a
TCGA-CV 5971 01A 11D 1683 08 HNSC 881a530b-fdd2-4674-b95d-fded0dfce4ff
TCGA-CV 5973 01A 11D 1683 08 HNSC b848fbad-leb3-4bc2-9006-2d0ca559cee8
TCGA-CV 5976 01A 11D 1683 08 HNSC 713643ce3-43bc-4a14-942a-Od6fcffa0312
TCGA-CV 5977 01A 11D 1683 08 HNSC 81f3c96a-54bb-4629-a64e-7c8dae66e1 1
a
TCGA-CV-5978-01A-11D-1683-08 HNSC 791d4f3f-90e0-4fa5-9671-9b5104ed3eca
TCGA-CV 5979 01A 11D 1683 08 IINSC c2c31b58-c5b3-4fc3-be99-b978d2961f86
TCGA-CV 6003 01A 11D 1683 08 HNSC 9a040a5e-3d2b-433a-9786-7c26b433c0c2
TCGA-CV 6433 01A 11D 1683 08 HNSC 16b220fa-a554-43c9-85b0-315331e5ba6e
TCGA-CV 6436 01A 11D 1683 08 HNSC a5214457-3a86-4b29-b116-3baaa0aa5099
TCGA-CV 6441 01A 11D 1683 08 HNSC 22b32736-3b91-4542-affa-46fa90819e69
TCGA-CV 6933 01A 11D 1912 08 HNSC 8ef4b02e-4d34-4d58-aa2d-65a7f73982d5
TCGA-CV-6934-01A-11D-1912-08 HNSC f5ab1385-0372-41aa-9558-8b102381b68b
TCGA-CV 6935 01A 11D 1912 08 HNSC fdcOebce-5ba2-4c18-b594-50b33ef6d116
TCGA-CV-6936-01A-11D-1912-08 HNSC 2d40dd75-d967-40b2-b55d-99e59cc7e125
TCGA-CV 6937 01A 11D 2012 08 IINSC 1c78a20e-150f-4c12-8abe-b941f90e730f
TCGA-CV-6938-01A-11D-1912-08 HNSC bldcb76e-b98f-4989-90a2-885e50d8174c
TCGA-CV-6939-01A-11D-1912-08 HNSC e2e84cc1-2944-489e-belb-0018a4e723e4
TCGA-CV 6940 01A 11D 1912 08 HNSC 39f2e005-
79f9-4c63-a6d6-06378481 a3b a ¨
TCGA-CV 6941 01A 11D 1912 08 HNSC 87071681-0058-4081-91f3-f689a150fc94
TCGA-CV 6942 01A 21D 2012 08 HNSC c5409f12-e438-4979-b40e-120899c1fa15
TCGA-CV-6943-01A-11D-1912-08 HNSC 4fa37ade-3451-406d-b0bb-e135e1591b70
TCGA-CV-6945-01A-11D-1912-08 HNSC fcfc9674-5b8a-45b7-97ca-4e477e941e7c
TCGA-CV 6948 01A 11D 1912 08 HNSC 03eb2650-499f-46d2-b091-378d8e919ae2
181

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-CV 6950 01A 11D 1912 08 HNSC 4a341860-44fb-493e-bd46-aeb6610842de
TCGA-CV 6951 01A 11D 1912 08 HNSC 9e1bf26c-6a68-44d2-aaa8-9af2f67828aa
TCGA-CV-6952-01A-11D-1912-08 HNSC 2d859062-3655-471e-b3dd-e6ff0671c076
TCGA-CV 6953 01A 11D 1912 08 HNSC fb79f2be-3dec-4b5a-b5f3-e29e0fb05a98
TCGA-CV-6954-01A-11D-1912-08 HNSC 08f56645-763e-4864-a145-c0136dacd4f5
TCGA-CV-6955-01A-11D-2012-08 IINSC f2c7fbe1-af36-4c42-b5ae-b9bf1e88fe36
TCGA-CV-6956-01A-21D-2012-08 HNSC 9ccee056-124e-40d5-a07d-c208765d8640
TCGA-CV-6959-01A-11D-1912-08 HNSC ff4cc4f1-9897-4d04-a3f6-c28a9b928b7a
TCGA-CV-6960-01A-41D-2012-08 HNSC 750da72e-cabd-4b97-8160-8c4e39272b8b
TCGA-CV 6962 01A 11D 1912 08 HNSC 0b2767d9-10b4-4ec4-9437-5a5186e284ca
TCGA-CV-7089-01A-11D-2012-08 IINSC 125ccb76-bf8d-4ce7-a04c-4424d6da0322
TCGA-CV-7090-01A-11D-2012-08 HNSC 5c636c2d-f426-43a9-984d-b4455e4388e5
TCGA-CV-7091-01A-11D-2012-08 HNSC 563c5a89-6dad-467e-02ea-e07677574a08
TCGA-CV-7095-01A-21D-2012-08 HNSC e4aba107-a048-46e5-b0aa-901f076b6f61
TCGA-CV 7097 01A 11D 2012 08 IINSC 23336d44-bb79-4361-b661-ce26eae06692
TCGA-CV-7099-01A-41D-2012-08 HNSC 12a04e68-c814-4a18-a469-d7edc76e362d
TCGA-CV-7100-01A-11D-2012-08 HNSC f21a5elf-84b8-4e6f-8230-03d31cc7c431
TCGA-CV-7101-01A-11D-2012-08 HNSC 511c3fa8-476b-4ee8-8e93-1a646bc40dbe
TCGA-CV-7102-01A-11D-2012-08 HNSC eda5514f-3aa1-447c-ad07-55ec307c26e3
TCGA-CV 7103 01A 21D 2012 08 HNSC e04f3556-ae16-410d-bc03-1057ae308329
TCGA-CV-7104-01A-11D-2012-08 HNSC 4f429401471e-4908-9663-2e66bacbebdd
TCGA-CV 7177 01A 11D 2012 08 HNSC c984165c-88ea-4840-a980-be818db16820
TCGA-CV-7178-01A-21D-2012-08 HNSC 3f30774f-208c-4057-abd 1 -a9dd 1
e49ec78
TCGA-CV-7180-01A-11D-2012-08 IINSC 4233a363-ba28-495c-8590-644199c33d64
TCGA-CV 7183 01A 11D 2012 08 HNSC 172e7b30-829e-40b2-976e-4971cd1724a9
TCGA-CV-7235-01A-11D-2012-08 HNSC 1758147b-cb09-430b-a8cb-6a144744a79f
TCGA-CV-7236-01A-11D-2012-08 HNSC dc220a9d-1f16-4fe3-8196-d837a909f038
TCGA-CV-7238-01A-11D-2012-08 HNSC e9619e49-7185-4158-9e8b-45d446960b60
TCGA-CV-7242-01A-11D-2012-08 HNSC 9c07a1bc-f7c7-4cb4-b3b1-92162a79de0e
TCGA-CV-7243-01A-11D-2012-08 HNSC bc6a2b7c-8a6c-4084-8551-8d1db9072ec2
TCGA-CV-7245-01A-11D-2012-08 HNSC 56291b3c-595c-4388-a264-9037a48401d8
TCGA-CV-7247-01A-11D-2012-08 HNSC b0ce56(12-8e2b-4214-ac59-d37ba5a7a2c3
TCGA-CV-7248-01A-11D-2012-08 IINSC 8ffc7f9d-16da-4cff-b845-f2ff8df87569
TCGA-CV-7250-01A-11D-2012-08 HNSC 14516d2b-47dc-4768-977b-bc3c1fe93722
TCGA-CV-7252-01A-11D-2012-08 HNSC 9692c6b2-ce97-4c92-a0dd-f27d01a94e6e
TCGA-CV-7253-01A-11D-2012-08 HNSC d501a7e5-
70e7-4f80-851a-efe8859d603a ¨
TCGA-CV-7254-01A-11D-2012-08 HNSC fd22e861-571e-44da-82b6-b128e07d1963
TCGA-CV-7255-01A-11D-2012-08 HNSC 4dedba61-e137-4ae4-8312-9423 le3b1d16
TCGA-CV-7261-01A-11D-2012-08 HNSC 9fa7bc79-d05b-41da-8bcc-8d5ad4451b0c
TCGA-CV-7263-01A-11D-2012-08 HNSC 19a07472-c8b9-4a34-b2cb-11ace35e7903
TCGA-CV-7406-01A-11D-2078-08 HNSC 8c9effa8-ac06-4c1b0-874a-8f0df386924c
182

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-CV-7407-01A-11D-2078-08 HNSC 9463 ldc8-6dcb-49ed-b068-e 1
a57a65f1cb
TCGA-CV-7409-01A-31D-2229-08 HNSC 47fa56f1-0802-403a-a644-913f1a0fdeca
1CGA-CV-7410-01A-21D-2078-08 HNSC b89c4194-1307c-485b-95ba-ffe815616d78
TCGA-CV 7411 01A 11D 2078 08 HNSC 790e387e-9e87-48d0-bc9d-2bc92f20abc5
TCGA-CV-7413-01A-11D-2078-08 HNSC be482a19-0de0-4e60-a831-9e0e 8545 a6
f3
TCGA-CV-7414-01A-11D-2078-08 IINSC 7137f980-5301-4b18-9664-d887eaced75e
TCGA-CV-7415-01A-11D-2078-08 HNSC bb1e4188-130c-4206-8671-d7ce3eb8ee74
TCGA-CV-7418-01A-1 I D-2078-08 HNSC 25a70d044533-4e60-b9fc-e74d6000b296
TCGA-CV-7421-01A-11D-2078-08 HNSC ee675976-11447-48c8-bc67-6878a0d35e07
TCGA-CV 7422 01A 21D 2078 08 HNSC 5eb3f291-082c-48a8-b653-09264342adee
TCGA-CV-7423-01A-11D-2078-08 IINSC a99653e0-2751-4423-93f7-abcf258c9868
TCGA-CV-7424-01A-11D-2078-08 HNSC 76d5fe22-fd06-43f6-94a8-943a09db5fd6
TCGA-CV-7425-01A-11D-2078-08 HNSC f8cc6696-91d0-4eba-a765-ef7d044238ce
TCGA-CV-7427-01A-11D-2078-08 HNSC 3fdb4698-4a38-4a81-a403-01ce5568c225
TCGA-CV 7429 01A 11D 2129 08 IINSC 14b42e59-e519-4efc-8105-6f6b83d33353
TCGA-CV-7430-01A-11D-2129-08 HNSC 29a4027f-4d4f-4133-b40a-3bfab6d2ac9e
TCGA-CV-7432-01A-11D-2129-08 HNSC 60da7e3f-4d9c-463-856d-oce02e381028
TCGA-CV-7433-01A-11D-2129-08 HNSC 15380da5-6a0b-4649-b21b-ce1ed7d61b67
TCGA-CV-7434-01A-11D-2129-08 HNSC d64e4e80-e6c6-42c8-8bc6-0fa1b6475c51
TCGA-CV 7435 01A 11D 2129 08 HNSC 16b7fd85-3664-4c4a-9a43-48b107dbcf7f
1CGA-CV-7437-01A-21D-2129-08 HNSC 53413980-80cc-4c73-8b b6-31 a0 1
d6df86e
TCGA-CV 7438 01A 21D 2129 08 HNSC 6fd3ecf3-c87c-46c3-81f0-11e218936d61
TCGA-CV-7440-01A-11D-2129-08 HNSC 901c2ed5-8348-4dd9-a84c-6c0b18d6525e
TCGA-CX-7082-01A-11D-2012-08 IINSC 4c6c96b8-958e-4235-9673-8bf4ce0e6b38
TCGA-CX 7085 01A 21D 2012 08 HNSC 4f6ce10b-246d-49cd-8b60-01dcb175e634
TCGA-CX-7086-01A-1 ID-2078-08 HNSC dfcb7c6e-b0f4-4557-9669-4c58001093a0
TCGA-CX-7219-01A-11D-2012-08 HNSC 83192af6-60ab-402e-8990-e1060ca3ce4c
TCGA-D6-6515-01A-21D-1870-08 HNSC 15c4d640-884c-4d55-897e-2f68314423fe
TCGA-D6-6516-01A-11D-1870-08 HNSC 5ab94b24-1alf-4df7-a5c6-bldce8ee9be5
1CGA-D6 6517 01A 11D 1870 08 HNSC c553e4a2-ebea-43d6-8937-a48836856b5a
TCGA-D6-6823-01A-11D-1912-08 HNSC e1f4d8ef-f24a-417b-9f22-c03cd06b5275
TCGA-D6-6824-01A-11D-1912-08 HNSC b658aa3f-0812-4812-8254-816d9a4d7c04
TCGA-D6-6825-01A-21D-1912-08 IINSC 01f44db3-84dc-4196-888d-b0370bf582a5
TCGA-D6-6826-01A-11D-1912-08 HNSC 368030ac-f855-452a-a3d3-3698ab9a00dd
TCGA-D6-6827-01A-11D-1912-08 HNSC 059be819-9536-40c0-a751-5fe529a2f01f
TCGA-DQ-5624-01A-01D-1870-08 HNSC 01282192-
5bb6-4406-bbc7-33a42eba416b ¨
TCGA-DQ-5625-01A-01D-1870-08 HNSC 4e042e1d-8604-484a-0229-94b85745a478
TCGA-DQ-5629-01A-01D-1870-08 HNSC e748f828-0b80-47f3-aa92-fb3b2be0dee2
TCGA-DQ 5530 01A OlD 1870 08 HNSC 5aa7ff44-d4ff-4163-81db-9f09bec8d5b0
TCGA-DQ-5631-01A-01D-1870-08 HNSC e389975a-e588-48d4-9ed3-548e8ed9de1c
TCGA-DQ-7588-01A-11D-2078-08 HNSC 6aad9b01-6a99-4121-955f-7938af25a188
183

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-DQ-7589-01A-11D-2229-08 HNSC de34e28e-942b-442b-b745-7f2a0e56f3ff
TCGA-DQ-7590-01A-11D-2229-08 HNSC 5cbcfa67-f062-4a03-84ad-dabfbcf14514
1CGA-DQ-7591-01A-11D-2078-08 HNSC 406822fc-452d-462c-88d8-72d300975276
TCGA-DQ 7592 01A 11D 2078 08 HNSC d8e20636-2666-4b53-2285-25056028df98
TCGA-DQ-7594-01A-11D-2229-08 HNSC 92e689c0-08ab-4726-aedc-6344fedc99c0
TCGA-DQ-7595-01A-11D-2229-08 I INSC 7d504cd7-09f0-4691-alb2-
55fc7d206439
TCGA-F7-7848-01A-11D-2129-08 HNSC ba8a3e47-ee55-4c88-629F6d161ffaeld0
TCGA-H7-7774-01A-21D-2078-08 HNSC 0eb56792-e3be-4619-aef6-7424798622f6
TCGA-HD-7229-01A-11D-2012-08 HNSC 26627991-540f-47f4-95f3-259a493d2593
TCGA-HD-7753-01A-11D-2078-08 HNSC 7dc33525-6f57-4b12-9672-c9c845296ae3
TCGA-IID-7754-01A-11D-2078-08 I INSC 233ecdc4-0b42-4533-8908-
64ac7d3ac33b
TCGA-HD-7831-01A-11D-2129-08 HNSC ae914215-3612-4edb-9f5a-ce4a17154178
TCGA-HD-7832-01A-11D-2129-08 HNSC 374f3e37-87e5-4450-289f-0bde3981231e
TCGA-HD-7917-01A-11D-2229-08 HNSC 451948c9-3d16-4771-b006-28698580db2c
TCGA-IIL-7533-01A-11D-2229-08 I INSC fbf8f428-be9e-4713-884d-
c80ef662d622
TCGA-IQ-7630-01A-11D-2078-08 HNSC 80442509-c2f0-4047-956e-a3633dfd472b
TCGA4Q-7631-01A-11D-2078-08 HNSC 62266f1c-1642-4849-9278-41e827691aa7
TCGA4Q-7632-01A-11D-2078-08 HNSC 9fcfc377-2153-401c-9564-824569866096
TCGA-A3 3311 01A OlD 0966 08 RCC 9c095b70-9a64-48b0-8alc-45dd00a70019
TCGA-A3-3316-01A-01D-0966-08 RCC el241cff-4071-482e-be5b-adb9c46a480a
ICGA-A3-3317-01A-01D-0966-08 RCC cd12847f-6956-4697-9256-24a1ddc58ec4
TCGA-A3-3319-01A-01D-0966-08 RCC a771a7ad-8dfa-46ee-849d-4478798c4626
TCGA-A3-3320-01A-01D-0966-08 RCC 5c4ce718-d795-453c-89d8-186a60869e68
TCGA-A3-3322-01A RCC 6f329d07-3308-4c84-9113-2bf000e9be3b
TCGA-A3-3323-01A-01D-0966-08 RCC 21c50574-7496-4be5-b723-1fdb9801b208
TCGA-A3-3326-01A-01D-0966-08 RCC 60ed222b-cd0c-4bc5-acd0-39f207be3289
TCGA-A3-3346-01A-01D-0965-08 RCC c8a52c11-2278-4f15-80bb-c7115c2cd737
TCGA-A3-3347-01A-02D-1386-10 RCC 2f4a6bd7-16ff-4689-b41d-c5fabb878236
TCGA-A3-3349-01A-01D-1251-10 RCC c2b25716-9cb5-4598-89c7-f0655e24dbb3
1CGA-A3-3357-01A-02D-1421-08 RCC db6f5ad9-ae6e-4689-6146-1733f8352c54
TCGA-A3-3358-01A-01D-1534-10 RCC fd42af27-6f0f-48e8-a947-bb9c9f4770ef
TCGA-A3-3362-01A-02D-1386-10 RCC 03c9042a-0206-4f12-b444-62f435140e8d
TCGA-A3-3363-01A-01D-0966-08 RCC 34dac639-c2e5-447d-99c5-c6a3e15538fe
TCGA-A3-3365-01A RCC 8bc46209-7328-42e0-ad97-e557ec81048e
TCGA-A3-3367-01A-02D-1421-08 RCC 832091b9-35cc-4f36-9d5f-d699679ac421
TCGA-A3-3370-01A-02D-1421-08 RCC 21ce7121-
87b4-4686-9bf6-aff71d8b2223 ¨
TCGA-A3-3372-01A-01D-0966-08 RCC f9f50073-ald3-4c52-be78-529bd05c0ce4
TCGA-A3-3373-01A-02D-1421-08 RCC 6cbaac72-ca6e-4c4b-a016-1836959344c8
TCGA-A3-3376-01A-02D-1421-08 RCC 31031387-393f-4619-ba87-cfe7330afc13
TCGA-A3-3378-01A-01D-0966-08 RCC f04f3200-e743-4fed -2000-e6a8lbd d 6d
dd
TCGA-A3-3380-01A-01D-0966-08 RCC 269d4e2a-a425-4fde-bb51-588017f8b2b9
184

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-A3-3382-01A-01D-0966-08 RCC f10e1718-6fb8-4c08-bc28-439f26355cd2
TCGA-A3-3383-01A-01D-0966-08 RCC 2ca06f57-c7fa-4881-b9c0-dd3f9c1c4ca0
1CGA-A3-3385-01A RCC 1780aef6-1e9c-4167-9f55-48885d6e5874
TCGA-A3-3387-01A-01D-1534-10 RCC e9e149ff-79e0-48f9-9262-1f0bad865e77
TCGA-AK-3429-01A-02D-1386-10 RCC 1a51dee9-2101-4a17-9280-4bad5606848e
TCGA-AK-3430-01A RCC b16a82ca-2eaf-4b7a-b469-2be4a023fe2a
TCGA-AK-3436-01A-02D-1386-10 RCC 714cd118-7f2b-47a5-83f6-41b20674ad03
TCGA-AK 3444 01A OlD 0966 08 RCC ea794170-156d-4251-b899-abfd60b213b0
TCGA-AK-3451-01A RCC 242777f6-a875-4072-9696-8d7f7d718906
TCGA-AK-3455-01A-01D-0966-08 RCC 3fbeeda4-a6c4-45a4-a963-de6ea3f7e0ba
TCGA-AK-3456-01A-02D-1386-10 RCC d36felbe-96a5-4001-a95e-d499a6087146
TCGA-AK 3458 01A OlD 1501 10 RCC 0198f3c3-78f2-4c19-90d5-c77674044ca2
TCGA-AS-3778-01A-01D-0966-08 RCC 7b56e923-2bc5-4368-8e28-42649d3bf169
TCGA-B0-4700-01A-02D-1534-10 RCC 32c0433f-359c-44c3-b2df-d2a64df90175
TCGA-B0 4706 01A OlD 1501 10 RCC 040fdd9b-db76-4357-9aed-77a8cbde058d
TCGA-BO-4710-01A RCC 6fe8eb4b-ldc0-46b8-ae80-7dbd022c9431
TCGA-B0-4712-01A-01D-1501-10 RCC 032b33f8-ft79-47de-8cb2-d744eab8bd1a
TCGA-BO 4810 01A OlD 1501 10 RCC e014eeeb-c48e-42bb-a683-93299087a3ef
TCGA-BO 4811 01A OlD 1501 10 RCC a46182dc-2481-4911-9f6b-9532666f9f8c
TCGA-B0-4815-01A-01D-1501-10 RCC fe091054-41d3-44fa-86a2-fad3ae58423f
TCGA-B0-4816-01A RCC d05c3419-4164-4a69-8611-ce1f5c29b5d4
TCGA-BO 4818 01A OlD 1501 10 RCC 213bf382-c2ca-45d4-95ae-329e6653620f
TCGA-B0-4823-01A-02D-1421-08 RCC 91790e7e-3475-4242-82fc-cbdd461ce5ef
TCGA-B0-4827-01A-02D-1421-08 RCC 02f83f9a-4e4d-44f3-8d67-b4fe2d35102b
TCGA-B0-4842-01A-02D-1421-08 RCC ae765ade-6a06-439c-alcd-67222a70f44e
TCGA-B0-4852-01A-01D-1501-10 RCC 28dbeb57-c919-4f91-aa3c-7b8f3809011e
TCGA-B0-4945-01A-01D-1421-08 RCC 9fae377f-6e63-4f47-a769-a1396t115f56
TCGA-BO-5075-01A RCC 200819c3-826e-49a1-8824-6d4752e6eb6f
TCGA-B0-5077-01A-01D-1462-08 RCC 587f2bd8-952a-4f31-98c7-7654c80b8a99
TCGA-BO 5080 01A OlD 1501 10 RCC 9adf0a63-1d5c-403a-9e78-eb9d62a249a4
TCGA-B0-5081-01A-01D-1462-08 RCC 71a9d096-0e27-4585-b54a-48214d83cd6c
TCGA-B0-5085-01A-01D-1462-08 RCC a36e36ee-48f3-4674-a913-a121a09535c5
TCGA-B0-5088-01A-01D-1462-08 RCC e56245d6-c681-44e0-9eb2-504bee3e1b32
TCGA-B0-5092-01A-01D-1421-08 RCC 76b9d9e3-6010-4894-8435-debe95a376b5
TCGA-B0-5094-01A-01D-1421-08 RCC 8b910c03-86a9-488d-8064-1f8c214c2941
1CGA-B0-5095-01A-011)-1421-08 RCC 93c714f8-acea-4550-92fe-aad4aad65ac9
TCGA-B0-5096-01A-01D-1421-08 RCC 261de0a2-6006-4b3b-aac0-37d9b33840aa
TCGA-B0-5097-01A-01D-1421-08 RCC 3af2978e-b892-4817-be05-39f020c06b5e
TCGA-B0-5099-01A-01D-1421-08 RCC c3150136-ae55-49d0-9212-86728464167d
TCGA-B0-5100-01A-011)-1421-08 RCC b20bd619-59c9-4e2a-8e64-7b644eaa75ce
TCGA-B0-5102-01A-01D-1421-08 RCC abea5e3e-705a-4d2c-b207-1ab43767a19b
185

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-BO-5104-01A RCC ac2cfbde-9d62-49db-9 a07-e8166003f1 Of
TCGA-B0-5106-01A-01D-1421-08 RCC c0c28603-7204-416d-ba3d-5377a38f677d
1CGA-B0-5107-01A RCC 4c6f4edb-9a29-48e6-8521-9c5fd2572e2d
TCGA-B0-5108-01A-01D-1421-08 RCC d1d37a18-d2c3-4825-8e47-1a2e52e3acbb
TCGA-B0-5109-01A-02D-1421-08 RCC 58d6e408-ed00-4e1f-bffa-e73250cfe4a0
TCGA-BO-5110-01A RCC 38041aeb-60fe-4784-a5d8-fd04b5c0c5f8
TCGA-B0-5113-01A-01D-1421-08 RCC 64b234e0-74f6-453f-b5cb-280e011ba09b
TCGA-B0-5115-01A-01D-1421-08 RCC f122b61c-d537-4456-84e8-54e541eec531
TCGA-BO-5116-01A RCC 97421d06-b199-4246-b2da-80a9ba313335
TCGA-B0-5119-01A-02D-1421-08 RCC 414d47c7-41bb-4c83-8cdf-703fa0a46f01
TCGA-B0-5120-01A-01D-1421-08 RCC 6ce58fbc-6742-4ade-84b0-cd025266e030
TCGA-B0-5121-01A-02D-1421-08 RCC a2751cb2-8545-490c-92d9-edb9775d32b8
TCGA-BO-5399-01A RCC aldddbed-c780-412a-b563-914f71e5c75d
TCGA-B0-5400-01A-01D-1501-10 RCC e7128330-77b1-48be-b9f0-be986aa63ea8
TCGA-B0-5402-01A-01D-1501-10 RCC ca62bea0-a008-481e-8a91-d0f3a9598255
TCGA-B0-5691-01A-11D-1534-10 RCC ac2e1d29-e239-4dab-9d81-77c8d45970eb
TCGA-B0-5692-01A-11D-1534-10 RCC laf40135-8357-40b7-b711-478633a70f97
TCGA-B0-5693-01A-11D-1534-10 RCC be92ee16-6288-46c0-aaa7-7a27020cd7ca
TCGA-BO 5694 01A 11D 1534 10 RCC 6edbaa05-b935-41132-b070-8fc80ea6b609
TCGA-BO-5695-01A RCC 86e4862c-7405-40b5-b73f-bc0c6c52ea6d
1CGA-B0 5696 01A 11D 1534 10 RCC 48b270af-07f2-4c65-ace2-e2676ffaccd9
TCGA-BO 5697 01A 11D 1534 10 RCC 9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66
TCGA-B0-5698-01A-11D-1669-08 RCC 2ddf2fa6-7871-49 fb-be2c-8fce6f8e41ed
TCGA-BO-5699-01A RCC 086554a9-2172-43a7-9f52-aab7d0888429
TCGA-B0-5701-01A-11D-1534-10 RCC 0c1c563a-ce60-478b-9286-ed90e7561892
TCGA-B0-5702-01A-11D-1534-10 RCC 780b3f3e-1c49-40de-9131-65c4df9ebba6
TCGA-B0-5703-01A-11D-1534-10 RCC 963400a2-d939-41a5-8c42-9fc3a04b8362
TCGA-B0-5705-01A-11D-1534-10 RCC d3095df5-5466-4b98-9f6d-f8ae8916ccca
TCGA-B0-5706-01A-11D-1534-10 RCC b60cf910-2d2e-483a-a9de-ce1e5f8d3825
TCGA-BO 5707 01A 11D 1534 10 RCC eb2f9f38-bce2-4746-a3c8-40abc3379b32
TCGA-B0-5709-01A-11D-1534-10 RCC bfeaecbe-7148-4642-b69a-b908a248f328
TCGA-BO 5710 01A 11D 1669 08 RCC 12f1e370-c269-4b95-a89b-a1f3ae42e876
TCGA-BO 5711 01A 11D 1669 08 RCC cf09ae91-5523-494c-8f30-c26f6ba37624
TCGA-B0-5713-01A-11D-1669-08 RCC 2f35dbf4-3223-4550-951b-1409a30ece68
TCGA-B0-5812-01A-11D-1669-08 RCC 6327ce2c-8a24-45b9-9577-7b7d7b603c68
1CGA-B2-3924-01A RCC 21527594-ed75-4654-9caf-83d31f248e67
TCGA-B2-4098-01A RCC 6463ae73-a885-4d69-9345-7110ddac0c7e
TCGA-B2-4099-01A RCC e242adb8-db67-475e-a0e4-52a622666b12
TCGA-B2-4101-01A RCC a9947b6c-dbc7-4ba5-af61-7647e1 1e2973
TCGA-B4-5377-01A-01D-1501-10 RCC a615b02d-td18-47et-bd66-6dba56de6981
TCGA-B8-4143-01A-01D-1806-10 RCC bb186c78-1052-48ec-97f4-c94bdd1Od172
186

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-B8-4146-01B-11D-1669-08 RCC 380bdba7-8a12-4136-877a-f54346d2d8a5
TCGA-B8-4148-01A-02D-1386-10 RCC fe752e2b-e694-4fa9-99d6-46d5bff9e8cf
1CGA-B8 4151 01A OlD 1806 10 RCC 3f847558-8bc7-49b0-899d-2a7b 8f0e3d1 a
TCGA-B8 4153 01B 11D 1669 08 RCC a66078d8-a6b2-4dc4-bfa3-def5a2e4504f
TCGA-B8-4154-01A-01D-1251-10 RCC e48f5c14-4b64-4d4b-8273-bebc74182181
TCGA-B8-4620-01A RCC e4ec1484-4f77-4520-9ff5-bc4dc8a0f1)15
TCGA-B8-4621-01A RCC 242a72ad-5968-4bbf-936d-75b398a61b96
TCGA-B8-4622-01A RCC 1c86e0f6-a019-47a5-8325-bbb82f76488c
TCGA-B8-5158-01A-01D-1421-08 RCC 9d730534-98e7-464e-945c-5964cec5362a
TCGA-B8-5159-01A-01D-1421-08 RCC ed8a9be1-31c6-40e2-9af2-8abd80d00995
TCGA-B8-5163-01A-01D-1421-08 RCC 903132ef-877f-4207-ba28-2e9dd765c824
TCGA-B8-5164-01A RCC 471ce542-e85b-4bdb-b365-4562a93ef1e5
TCGA-B8-5165-01A-01D-1421-08 RCC d1579785-5c42-4bda-9825-15ead235f7f4
TCGA-B8-5545-01A-01D-1669-08 RCC 514d2342-64ba-4c9f-9866-63bdbc26fda3
TCGA-B8-5550-01A RCC dafed455-98a2-419a-bebc-f90b731e2813
TCGA-B8-5552-01B-11D-1669-08 RCC 13b52e49-20df-4e39-9dc9-cf817c157bd7
TCGA-B8-5553-01A-01D-1534-10 RCC 7c19e63c-770b-4289-aa47-9b2cf261b4ca
TCGA-BP-4161-01A RCC 154de511-2bba-4959-970b-6a8429f29793
TCGA-BP-4162-01A RCC ca4eac28-22c9-48d8-8139-7cda2cfe4ae2
TCGA-BP-4163-01A RCC e44de28c-bce0-471d-bd4c-bea710f7c3cc
TCGA-BP-4164-01A RCC a8fab76e-ae69-43d6-972b-5837aec668fd
TCGA-BP 4167 01A 02D 1386 10 RCC 796810e1-4de4-496d-9f70-ab62246e781b
TCGA-BP-4770-01A-01D-1501-10 RCC aecbc5db-175a-42d0-a84d-aa0369b08eec
TCGA-BP-4782-01A RCC a6c21bf2-dd9b-4243-863e-9d53b056666f
TCGA-BP-4801-01A-02D-1421-08 RCC d3e62cb1-5ced-42cb-a360-479ce01877aa
TCGA-BP-4960-01A-01D-1462-08 RCC 36d21be3-2f46-47af-84aa-2305f2513aal
TCGA-BP-4961-01A RCC f207131d-8db7-464b-a3e5-44218da1cafc
TCGA-BP-4962-01A-01D-1462-08 RCC 3454a61e-2547-4531-a0be-cb27c1879e72
TCGA-BP-4963-01A-01D-1462-08 RCC 154bfa5d-0d9a-40c6-a2a5-bde1054702c3
1CGA-BP-4964-01A-01D-1462-08 RCC 5b838251-67f5-4e22-a291-8a9e206d56db
TCGA-BP-4967-01A-01D-1462-08 RCC 75866d14-47d5-4560-a5a0-32ba3e15ac63
TCGA-BP-4968-01A-01D-1462-08 RCC d777d5ec-4632-446e-aeac-8ae3e5273fe2
TCGA-BP-4970-01A-01D-1462-08 RCC 205e81c6-235a-450f-blf8-80c518eb3478
TCGA-BP-4971-01A-01D-1462-08 RCC c07945e8-8133-4237-9d1f-18c023bc9d2c
TCGA-BP-4972-01A-01D-1462-08 RCC b2da5d39-33f6-4807-9d1d-92b7cef2a8df
TCGA-BP-4973-01A-01D-1462-08 RCC 5db95dcc-
97e3-42a5-87dd-75a09b9c164a ¨
TCGA-BP-4974-01A RCC a75c9262-c67b-42b5-a8c2-7eea1b567ed0
TCGA-BP-4975-01A-01D-1462-08 RCC 109d2752-17f8-4b00-a61f-dfd8e2e3ca81
TCGA-BP-4976-01A-01D-1462-08 RCC 95bd8lec-3c06-4c4d-9915-5cc3dd7a7155
TCGA-BP-4977-01A-01D-1462-08 RCC 7c3bf7c1-
0719-4540-9a5e-614f460b63ec -,
TCGA-BP-4981-01A-01D-1462-08 RCC 64a1f085-50cc-4129-a617-e0f691a58039
187

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-BP-4982-01A-01D-1462-08 RCC 84591a73-9ed0-4ad5-9acd-8f31acf27af0
TCGA-BP-4983-01A-01D-1462-08 RCC beaafdf9-d5c0-4bc4-b08b-833c3c91c9ae
TCGA-BP-4985-01A-01D-1462-08 RCC e56acfea-aec6-4102-8fe0-25df396c10ae
TCGA-BP-4986-01A-01D-1462-08 RCC 4465171a-d048-4078-b1ae-021b2c635ff4
TCGA-BP-4987-01A-01D-1462-08 RCC 7924f8f1-8e78-4910-9dc5-db14d5ee7011
TCGA-BP-4988-01A-01D-1462-08 RCC 792c9867-ceea-4520-bbb7-5dabe290664f
TCGA-BP-4989-01A-01D-1462-08 RCC 7096085b-cd5b-4cd1-8957-a6adcf7e818a
TCGA-BP-4991-01A-01D-1462-08 RCC d54c714e-b1c4-4669-986d-5e13d2fc3cc3
TCGA-BP-4992-01A RCC 212717dd-25f1-4c76-a648-b827d65caecf
TCGA-BP-4993-01A-02D-1421-08 RCC 34315bea-6ef2-42ec-b17e-c73eed40647f
TCGA-BP-4995-01A-01D-1462-08 RCC 93b9afac-el 2e-49d2-96ac-274da6581d76
TCGA-BP-4998-01A-01D-1462-08 RCC e646f930-967b-43a3-bd70-184e5c38efe5
TCGA-BP-4999-01A-01D-1462-08 RCC 86f1b814-7c65-426b-b7b5-7250322c4d01
TCGA-BP-5000-01A-01D-1462-08 RCC b9816eaa-3c60-4fbf-abd6-6d869ca9cca7
TCGA-BP-5001-01A RCC e863bd35-0382-4979-b599-033a06a1f50b
TCGA-BP-5004-01A-01D-1462-08 RCC e3d82fe4-b491-4172-86da-429cf16508de
TCGA-BP-5006-01A-01D-1462-08 RCC 1 lfb962b-b4b8-46f4-bde4-3f87309e94f3
1CGA-BP-5007-01A RCC a44eb1d6-3b5c-42e8-b17a-d711fc0503d5
TCGA-BP-5008-01A RCC 41c094e9-6c23-4993-8d90-338b66efefc1
TCGA-BP-5009-01A-01D-1462-08 RCC 3baa3cdc-c63e-4556-bafl-c3b03175b0fa
TCGA-BP-5010-01A-02D-1421-08 RCC 553cbe18-6dd3-4b34-b7fe-96a6dd2e6943
TCGA-BP-5168-01A-01D-1421-08 RCC 9930560d-22e6-43aa-a6f0-02515f7af8f0
TCGA-BP-5169-01A-01D-1429-08 RCC 3527b2le-9726-4c31-b5de-8c394ce0e500
TCGA-BP-5170-01A-01D-1429-08 RCC 68761b2c-66b9-4adf-9b60-955f79ed0f11
TCGA-BP-5173-01A-01D-1429-08 RCC 3ce0a5fc-09ae-412a-8a5b-56d9a44433aa
TCGA-BP-5174-01A-01D-1429-08 RCC 53b5cf8d-f3cf-4e7e-91ec-b0c907d1c13f
TCGA-1-3P-5175-01A401D-1429-08 RCC 3 0e5ga 1 e-e7d11-43ce-a7e8-
alfc121f4438e
TCGA-BP-5176-01A-01D-1429-08 RCC 607eb48b-1647-4e35-ac60-f6c50341e304
TCGA-BP-5177-01A-01D-1429-08 RCC ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae
TCGA-BP-5178-01A-01D-1429-08 RCC 60888dc5-1408-4bfb-bf27-f3e22f5488e4
TCGA-BP-5180-01A-01D-1429-08 RCC a776bde5-7503-459c-8419-dc0d744a651e
TCGA-BP-5182-01A-01D-1429-08 RCC 00523547-dalc-4bb1-a627-c0946849b376
TCGA-BP-5183-01A-01D-1429-08 RCC cd4c37c3-95f2-4612-b6a8-9d6d1dfb5fd4
TCGA-BP-5184-01A-01D-1429-08 RCC ddebed14-f47f-46e6-ac39-c74ed3363211
TCGA-BP-5185-01A-01D-1429-08 RCC 42dc6d82-f52a-4b13-b3bc-c63002b47e98
TCGA-BP 5186 01A OlD 1429 08 RCC 02b98f85-07df-4tb2-627e-efd368c84ec8
TCGA-BP-5187-01A RCC 3257e690-9306-434f-b6ac-17da58ab1243
TCGA-BP-5189-01A-02D-1429-08 RCC ea98342a-65ec-468a-9ec1 -44c7d31a67d6
TCGA-BP-5190-01A-01D-1429-08 RCC 5491645b-552c-47a9-b081-e8e508d1df3d
TCGA-BP-5191-01A-01D-1429-08 RCC 64dd8a08-483e-4dce-9060-64a751tdbebd
TCGA-BP-5192-01A-01D-1429-08 RCC 4db23b76-46dd-4ed9-a168-fee43b2fc7d7
188

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-BP-5194-01A-02D-1429-08 RCC 5b52c97e-fdd2-4ae2-b036-297feeb1c7e2
TCGA-BP-5195-01A-02D-1429-08 RCC c2ab2f01-3744-434a-b5b6-0f22599c9a17
1CGA-BP-5196-01A-01D-1429-08 RCC 201b107d-0be9-442f-ad66-15ea8e7e812d
TCGA-BP-5198-01A-01D-1429-08 RCC ac66d658-97d4-416b-8028-0077a1e8a01d
TCGA-BP-5199-01A-01D-1429-08 RCC 135f3b77-1474-40d8-87a1-15939136e8cd
TCGA-BP-5200-01A RCC e2557bba-b331-40c2-8389-c52324630bca
TCGA-BP-5201-01A-01D-1429-08 RCC 243c77a9-1591-45ac-b048-a5687a77c764
TCGA-BP-5202-01A-02D-1429-08 RCC accc7214-d441-4a72-a2eb-9f2811c38a3e
TCGA-CJ-4634-01A-02D-1386-10 RCC 59f18fac-c6f8-4ebf-9259-8c22d6ba0c58
TCGA-CJ-4636-01A RCC 5889076d-0a5f-4c3a-8254-a941df3186f7
TCGA-CJ-4637-01A-02D-1386-10 RCC b8480571-ee08-4fal-b509-1331a8fbc075
TCGA-CJ-4638-01A-02D-1386-10 RCC ebe187b0-fafe-4b1f-9af0-6714942414ab
TCGA-CJ-4639-01A-02D-1386-10 RCC 9df6d1b1-5a09-4082-8ec0-61b12b3c8801
TCGA-CJ-4640-01A-02D-1386-10 RCC e406036a-eecb-474e-8c76-0fa8b64225be
TCGA-CJ-4641-01A-02D-1386-10 RCC c00265ac-c6cc-4349-ac30-e2e44582015a
TCGA-CJ-4643-01A-02D-1386-10 RCC 5e00e420-94fd-4115-9cd9-eef24f6df0eb
TCGA-CJ-4644-01A-02D-1386-10 RCC 2f28881b-ae20-4347-87dc-f0eeeeb9b0d5
TCGA-CJ-4882-01A-02D-1429-08 RCC b1b7b8e8-ce87-4a52-900a-1f3ef7d449d7
TCGA-CJ-4897-01A-03D-1429-08 RCC e 1 33 leec-e2df-4924-918b-
7e5134e933c2
TCGA-CJ-4899-01A-01D-1462-08 RCC 943ca428-39f6-4ad2-8ea5-220628a6b5bb
TCGA-CJ-4901-01A-01D-1429-08 RCC a8a8f3ff-0514-4bca-be75-16ad58eb9e72
TCGA-CJ 4902 01A OID 1429 08 RCC 3ef9ea62-85c4-4261-a123-ecb86f192cdf
TCGA-CJ-4903-01A-01D-1429-08 RCC 3b685193-flfa-4c1b-9490-bcdb2d1b934c
TCGA-CJ-4904-01A-02D-1429-08 RCC 9bedcded-Oc33-4199-bdce-18681595c2d8
TCGA-CJ-4905-01A-02D-1429-08 RCC 22eb9dc5-8d5e-4158-8edc-12ff62a612be
TCGA-CJ-4907-01A-01D-1429-08 RCC 7e69feb9-4b94-478a-beb3-6ebd162d9482
TCGA-C1-4908-01A-01D-1429-08 RCC dbc5420c-5c60-4d1e-8554-9d2f6e55c502
TCGA-CJ 4912 01A OID 1429 08 RCC 894ade93-8feb-4193-a31 a-d9e16eb81743
TCGA-CJ 4913 01A OID 1429 08 RCC 0635f266-c4be-45ea-8347-455ef7ad5648
TCGA-CJ 4916 01A OID 1429 08 RCC 81b0e02c-069c-4c4b-b56f-79c2ebec9927
TCGA-CJ-4918-01A-01D-1429-08 RCC 2e5d4600-0271-4c03-ab44-239acl9d8b4d
TCGA-CJ-4920-01A-01D-1429-08 RCC 12bf3338-f541-45a9-9fb7-e84931ba5ed8
TCGA-CJ 4923 01A OID 1429 08 RCC 19171 al a-6483-4bf3-b0b4-8ed441303c55
TCGA-CJ 5671 01A 11D 1534 10 RCC 5b1084bb-3fb2-4f3f-9ca7-7108b0f77994
TCGA-CJ 5672 01A 11D 1534 10 RCC 61497c42-78f2-43d4-92ab-2b 1 e655271a8
TCGA-CJ-5675-01A RCC 26f77108-c3b0-4833-9ala-df457d7415a9
1CGA-CJ 5676 01A 11D 1534 10 RCC 2e8aa293-650b-4661-b130-8b70f0949686
TCGA-CJ 5677 01A 11D 1534 10 RCC 70fe0b18-52d1-40f7-b2a3-c808b3009610
TCGA-CJ-5678-01A-11D-1534-10 RCC d49759a2-d2a9-48ba-9447-e42c9d3d64c7
TCGA-CJ-5679-01A RCC 17313700-6052-4901-8850-981fead99d6c
TCGA-CJ 5680 01A 11D 1534 10 RCC 2e718814-9d25-49a6-a430-2019071ee0ab
189

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-CJ 5681 01A 11D 1534 10 RCC 9ae0744a-9bc1-4cd7-b7cf-c6569ed9e4aa
TCGA-CJ 5682 01A 11D 1534 10 RCC deceb0ba-600f-491a-a207-2e0205ff89d2
TCGA-CJ 5683 01A 11D 1534 10 RCC b85e29c5-0206-4d65-aa46-179a55c0ceae
TCGA-CJ 5684 01A 11D 1534 10 RCC 24ee4b71-c2e0-44c3-aaeb-3c488cd26ce7
TCGA-CJ-5686-01A-11D-1669-08 RCC 695e2a72-6b97-4fa 1 -9f57-d7c6e10438ee
TCGA-CJ 6027 01A 11D 1669 08 RCC b0483455-4cde-408f-b831-17223c03241a
TCGA-CJ-6028-01A-11D-1669-08 RCC d165717a-cc3d-4533-8194-0029c186f1bb
TCGA-CJ 6030 01A IID 1669 08 RCC c904299c-09a8-4a4c-9378-2fee0ac4cd33
TCGA-CJ-6031-01A-11D-1669-08 RCC a47debc7-700e-4c64-a9b3-1113609alddf
TCGA-CJ 6032 01A 11D 1669 08 RCC 8c982310-69af-474d-adb7-5ec8ef4e5af7
TCGA-CJ 6033 01A 11D 1669 08 RCC c7ce9042-f63c-4a93-a82d-f21977bd9bcb
TCGA CW 5580 01A OlD 1669 08 RCC 6e4ed3ae-aa80-453a-95be-0a196a7bc4e3
TCGA-CW-5581-01A RCC 22be4bab-231e-4784-aaa9-45ae158a5153
TCGA CW 5583 01A 02D 1534 10 RCC 2cb6b578-8543-4a12-8331-1721ddc47303
TCGA CW 5585 01A OlD 1534 10 RCC bd6d9aa8-dOef-4810-a43c-eacdd846c44e
TCGA-CW-5591-01A-01D-1534-10 RCC 02ac80cd-caa3-4dbc-9b57-4a324cec0ad4
TCGA CW 6087 01A IID 1669 08 RCC 65c23a97-1763-47d5-8648-df24c10226f3
TCGA CW 6090 01A I1D 1669 08 RCC 3b2e654a-4c13-4dab-9e18-1445a43af3e6
TCGA CAA% 6093 01A IID 1669 08 RCC 9b1beb37-led7-43c0-a532-56df7941111f
TCGA-CZ-4853-0IA-01D-1429-08 RCC bdef62d1-a036-43b4-811b-bf4beab7eca8
TCGA-CZ-4856-0IA-02D-1429-08 RCC 85e26450-4cb 1-4a9 1 -ad86-
a6d44890ee97
TCGA-CZ-4859-0IA-02D-1429-08 RCC 82c0b6e4-cb0f-4870-81c9-b45a93d6f5d3
TCGA-CZ-4863-01A-01D-1501-10 RCC 4286d73b-Ifb9-41a3-baba-46f23100586a
TCGA-CZ-4865-01 A-02D-1501-10 RCC f8eac30d-1155-44cc-a2ad-95427fecf4bf
TCGA-CZ-4866-01A-01D-1501-10 RCC a3a06421-7838-4ac2-b5d5-45d2ea651368
TCGA-CZ-5451-01A-01D-1501-10 RCC b1923d68-1dle-4b59-b643-09e2c5969efd
TCGA-CI-5452-01 A-01 D-1501-10 1-2CC 96M68cb-5d8e-4del-88ca-5f301bdde036
TCGA-CZ 5453 01A OlD 1501 10 RCC 605079f6-2d6e-4c38-a214-b4c8875dd166
TCGA-CZ-5454-01A-01D-1501-10 RCC d9fd1928-7b7d-4147-aeff-1618393ba26c
TCGA-CZ-5455-01A RCC d6a730ef-3f0d-47c1-977e-5c80647356d4
TCGA-CZ-5456-01A-01D-1501-10 RCC 45d5c746-60e3-4531-8db0-fd648811d45f
TCGA-CZ-5457-0IA RCC 8d54b22b-ee4b-45e0-922e-24e3c20c4c I a
TCGA-CZ 5458 01A OlD 1501 10 RCC 1737382a-alc9-45e1-b009-a29be1d93749
TCGA-CZ-5459-01A-01D-1501-10 RCC 5711cdaa-7368-4a4f-8639-5df60a2fedac
TCGA-CZ-5460-01A-01D-1501-10 RCC a6de1551-2ala-4a43-ba7f-caa436f5f6dd
TCGA-CZ-5461-01A-01D-1501-10 RCC 79feee74-7b14-48d9-9be7-8d7671c79c83
TCGA-CZ-5462-01A-01D-1501-10 RCC 74eed0c6-b3cc-4666-8ef0-194e1bbe1048
TCGA-CZ-5463-01A-01D-1501-10 RCC 3732539b-eb77-485b-81a1 -83be956a9a87
TCGA-CZ-5465-01A-01D-1806-10 RCC 062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37
TCGA-CZ-5466-0IA RCC 694ca445-7bac-4216-ac15-e227650ae973
TCGA-CZ 5467 01A OlD 1501 10 RCC 99c640a3-660f-4723-bf82-36fcb3134356
190

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-CZ-5468-01A-01D-1501-10 RCC 50c6b5a2-cdOe-4adf-b85b0f9c1847477f
TCGA-CZ-5469-01A-01D-1501-10 RCC 3df654a0-48b0-45fEbfel-b5f78f63b30d
1C(JA-CZ 5470 01A 01D 1501 10 RCC c9a7ca9e-c36e-46c1-926f4a57a058460
TCGA-CZ-5982-01A-11D-1669-08 RCC 2c3c0f78-1c0a-48df-856e-0afbc265bceb
TCGA-CZ-5984-01A-11D-1669-08 RCC 89e8e486-0c93-4056-88ed-83f90d5a7f2c
TCGA-CZ-5985-01A-11D-1669-08 RCC ad5eae3d-2f73-49d2-be47-5891e7772bc6
TCGA-CZ-5986-01A-11D-1669-08 RCC Oabded91-5a5f-4923-bcf0-7fdda64ae232
TCGA-CZ 5987 01A 11D 1669 08 RCC 84a1a8d2-54c6-4771-9092-27c5f7fc4e5c
TCGA-CZ-5988-01A-11D-1669-08 RCC 668172b3-1e6f-4362-8432-3651925686a6
TCGA-CZ-5989-01A-11D-1669-08 RCC 852e1614-35c0-4ba7-a29c-e8e2a91aalb7
TCGA-DV 5565 01A OlD 1534 10 RCC ee24d408-6043-4ca0-8bde-f29e798cc479
TCGA-DV 5566 01A OlD 1534 10 RCC 39a321cd-dbdf-474b-aead-6e69795470e0
TCGA-DV 5568 01A OlD 1534 10 RCC ecb100d4-24da-40d9-aee1-2901c13a655a
TCGA-EU 5904 01A 11D 1669 08 RCC 613e89f1-6836-4261-94al-e371d797237f
TCGA-EIJ-5905-01A-11D-1669-08 RCC 091c18b6-6fc2-4353-9eba-e6c46c2c18c5
TCGA-EU-5906-01A-11D-1669-08 RCC 050dc3b7-e560-44f4-a05c-8c792d8467a8
TCGA-EU-5907-01A-11D-1669-08 RCC 5fded36e-05ba-4cce-8303-738f5b04ad16
TCGA-AB 2807 03D 01W 0755 09 AML 3d15bdda-bbb7-4e3d-bdd6-7546d2905e95
TCGA-AB-2809-03D-01W-0755-09 AML d86f567d-84f8-4a95-afld-5a26ada92830
TCGA-AB-2814-03D-01W-0755-09 AML 604f0c72-efc7-4868-bc54-79d8f3f35076
TCGA-AB-2822-03D-01W-0755-09 AML 68b67026-2f30-4839-8579-7a0734168976
TCGA-AB-2825-03D-01W-0755-09 AML e6e4b579-9ddf-4fb1-bb65-db8321294852
TCGA-AB 2840 03D 01W 0755 09 AML cb122429-5601-4fad-6498-6034223013567
TCGA-AB-2845-03D-01W-0755-09 AML 98d27719-6f38-433a-ba0a-a14c632958d8
TCGA-AB-2853-03D-01W-0755-09 AML 9e238bbc-61ba-4966-b30e-ba7ab 1 a5b1
lb
TCGA-AB-2858-03D-01W-0755-09 AML b9dcb0aa-0098-49a9-a0c8-790a06dadea8
TCGA-AII-28634031)-01W-0755-09 AM!. d46a0ac2-9d98-4306-bbOd-elbada2d5486
TCGA-AB-2864-03D-01W-0755-09 AML 07f07406-597d-4067-6218-ef40aad6f06c
TCGA-AB-2872-03A-01W-0732-08 AML 495c3e6d-76f1-4999-894-761d50b70566
TCGA-AB-2909-03A-01W-0755-09 AML 39ad6508-a476-4a33-ae8d-6e25fa36369e
TCGA-AB-2912-03A-01W-0732-08 AML da01cad7-961b-46e2-8a80-9c846694ad5b
TCGA-AB-2918-03A-01W-0745-08 AML d0833641-77a1-41fd-6635-d216600d007b
TCGA-AB-2921-03A-01W-0755-09 AML 779697fe-899a-4b1b-a1d3-44a847487b6b
TCGA-AB-2926-03A-01W-0732-08 AML 890ea799-3156-40c3-839c-Oc60179006d7
TCGA-AB-2927-03A-01W-0755-09 AML 46bbb19d-2bc9-4f0a-ac4e-cad7327ca142
TCGA-AB 2934 03A 01W 0755 09 AML 7791e140-fe03-44d0-8250-47826ea993df
TCGA-AB-2946-03A-01W-0755-09 AML f24641b4-796f-4736-96c8-839218116695
TCGA-AB-2948-03A-01W-0755-09 AML 7b0f6197-8465-4306-9da7-322f2d218729
TCGA-05-4244-01A-01D-1105-08 LUAD 738c514d-ff0f-4220-9326-236119891df5
TCGA-05-4249-01A-01D-1105-08 LUAD 8be717b5-5b65-4631-a175-1f4c063d447e
TCGA-05 4250 01A OlD 1105 08 LUAD 41c4fe84-8beb-4a3a-920c-e74c7edd2182
191

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-05 4382 01A OlD 1265 08 LUAD 0056918d-e4a9-4971-9588-656a35c33dec
TCGA-05-4384-01A-01D-1753-08 LUAD 4c71b66b-813f-472b-b866-b34b5b9199e7
TCGA-05-4389-01A-01D-1265-08 LUAD c6f382d4-a522-4333-88b5-be7f55fe80f5
TCGA-05-4390-01A-02D-1753-08 LUAD d0854b5b-69be-4b84-aa37-ecddObc14de9
TCGA-05-4395-01A-01D-1265-08 T,IJAD de45b4de-4c03-4fe4-89e0-
dlef37808496
TCGA-05-4396-01A-21D-1855-08 LUAD 0176cf1d-0760-4769-a493-277f4bb7585e
TCGA-05-4397-01A-01D-1265-08 LUAD 4b7be121-49af-4a44-95dd-0a487d47228f
TCGA-05-4398-01A-01D-1265-08 LUAD 9e4b2be6-e149-4c22-93e1-512c3c6bbea8
TCGA-05-4402-01A-01D-1265-08 I,IJAD 75475 a84-582d-4949-a428-
1e28ad526d8c
TCGA-05-4403-01A-01D-1265-08 LUAD 7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f
TCGA-05-4405-01A-21D-1855-08 LUAD 3ef10eb8-d713-4fda-9e03-bc594b356d77
TCGA-05-4410-01A-21D-1855-08 LUAD f85d0d42-436b-4251-a7fd-7d0f5fddd397
TCGA-05-4415-01A-22D-1855-08 LUAD 128f52c7-49dc-4a9f-a5bc-lc14684edc9c
TCGA-05-4417-01A-22D-1855-08 LUAD 57e3657d-7a3c-4d80-a2c2-11e0293f5f05
TCGA-05-4418-01A-01D-1265-08 LUAD b07397ae-592b-4eb4-98b3-7c7e81ecb5e0
TCGA-05-4420-01A-01D-1265-08 LUAD 0536b000-eaf3-4cb2-b46b-8dd9f23c8199
TCGA-05-4422-01A-01D-1265-08 LUAD a5370f18-e8a9-43d8-9eb8-be678ccd4669
TCGA-05-4424-01A-22D-1855-08 LUAD fc500ff5-24c8-4965-94da-b4afafafe2dd
TCGA-05-4425-01A-01D-1753-08 LUAD 4a367804-9934-4241-90da-0ba0245564bd
TCGA-05-4426-01A-01D-1265-08 LUAD 117c6aff-8899-48f4-9328-746207d38eff
TCGA-05-4427-01A-21D-1855-08 LUAD 736e0134-8b 1 a-4ff1-9106-
ca09c9812ef6
TCGA-05-4430-01A-02D-1265-08 LUAD 23398531-3f4c-45e6-980b-755165c04974
TCGA-05-4432-01A-01D-1265-08 I T JAD 377a94af-0958-4b89-ac0c-
4cd49c1e4c2e
TCGA-05-4433-01A-22D-1855-08 LUAD fab4flca-1605-4c30-8b3e-badb44e66580
TCGA-05-4434-01A-01D-1265-08 LUAD f529778c-5968-4d87-80c0-bd14ba2311d0
TCGA-05-5420-01A-01D-1625-08 LUAD 8371b6a4-ffea-4fe5-b997-76ece85064a7
TCGA-05-5423-01A-01D-1625-08 LUAD 209d853d-6c50-4223-a572-a90d58aee51e
TCGA-05-5425-01A-02D-1625-08 LUAD 70a3e96b-dd26-419c-9a68-97dea0465d6e
TCGA-05 5428 01A OlD 1625 08 LUAD 7744a93b-0565-4d83-afad-caa02358f258
TCGA-05-5429-01A-01D-1625-08 LUAD 37d0cf1b-1743-4852-8073-372b1665c17d
TCGA-05 5715 01A OlD 1625 08 LUAD 62fda17b-lde0-4b7e-bd28-a6793bc36d37
TCGA-17 Z000 01A 01W 0746 08 LUAD ba9d9630-fc6c-4ffb-8464-c1a2ddec6579
TCGA-17 Z001 01A 01W 0746 08 LUAD d5e77555-9412-4e64-a6aa-65c996e3d521
TCGA-17-Z003-01A-01W-0746-08 LUAD 443d768f-b871-4149-9ef0-2d49bc0d05a1
TCGA-17-Z004-01A-01W-0746-08 LUAD cla70a4b-2879-48e8-87e1-b02c57d58705
TCGA-17 Z005 01A 01W 0746 08 LUAD 96b0bb86-6092-47ef-8088-fd0a4f261439
TCGA-17 Z007 01A 01W 0746 08 LUAD cac5bcdl-f044-4275-89cd-1110d0025537
TCGA-17-Z008-01A-01W-0746-08 T,IJAD 6b6ddf99-f050-4dfa-85a2-
d5a3e3ad56b0
TCGA-17-Z009-01A-01W-0746-08 LUAD 8c5a3460-clfa-4b7b-9b31-11f9c7b03255
TCGA-17 Ze10 01A 01W 0746 OS LUAD c9167916-74d0-4266-b5b8-705018e0e76b
TCGA-17 Zell 01A 01W 0746 08 LUAD d7495a00-b312-4502-9e1b-9e5f3dbf4b5d
192

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-17-Z012-01A-01W-0746-08 LUAD 861e9d45-df9a-41a6-9ddf-bc72f85aed80
TCGA-17-Z013-01A-01W-0746-08 LUAD ee0ebaf2-a0bb-4e58-9e52-5986b5f4f25e
1CGA-17 Z014 01A 01W 0746 08 LUAD ca24ac3d-4686-4f0c-a47d-0eff92a623b1
TCGA-17 Z015 01A 01W 0746 08 LUAD 770c22ba-b759-433e-8478-b6cf0d685447
TCGA-17-Z016-01A-01W-0746-08 LUAD 39bbd67b-52fd-46e5-98cf-b5632400216d
TCGA-17-Z017-01A-01W-0746-08 LUAD 37049bf1-55cb-44d3-b673-1e270ea835f7
TCGA-17-Z018-01A-01W-0746-08 LUAD ddla6leb-8362-41a9-952d-b7e6887457ad
TCGA-17-Z020-01A-01W-0746-08 LUAD 7ea20aa3-68cf-4389-9ace-99d6149d16c1
TCGA-17-7021-01A-01W-0746-08 LIJAD 9394b536-cd08-41411-86a3-
c6491f967709
TCGA-17-Z022-01A-01W-0746-08 LUAD 7f07e5b3-bf70-4690-84ba-a9eace798a24
TCGA-17-Z023-01A-01W-0746-08 LUAD bd72330a-463f-471b-9eba-2f188524e74c
TCGA-17-Z025-01A-01 W-0746-08 LUAD 99eab29e-32d3-49d5-aa30-56de8be556e7
TCGA-17 Z026 01A 01W 0746 08 LUAD bb048ffc-de00-4706-85bb-d052c0fb6496
TCGA-17-Z027-01A-01W-0746-08 LUAD 880452fe-00ed-4732-bbcf-14b55c235e61
TCGA-17 Z028 01A 01W 0746 08 LUAD 1f55fb6e-342a-41e0-9a8e-7c5156c95eaa
TCGA-17-Z030-01A-01W-0746-08 LUAD e35e27e8-6cc5-495b-9ae8-89f65d94ebed
TCGA-17 Z031 01A 01W 0746 08 LUAD 6516244a-dfd8-4568-a2d2-7556cbea52b1
TCGA-17-Z032-01A-01W-0746-08 LUAD 92bc438b-02c1-4b81-a90a-4a1302786a81
TCGA-17 Z033 01A 01W 0746 08 LUAD 639aea7c-5a38-4641-bf0d-90a9ce8e2980
TCGA-17-Z035-01A-01W-0746-08 LUAD a4bcbb2e-594f-4a89-8b72-8c922a64cdef
1CGA-17 Z036 01A 01W 0746 OS LUAD 374b881a-dbe2-4b4b-bfc0-8431f1aec06c
TCGA-17 Z037 01A 01W 0746 08 LUAD bffe237d-31b0-4950-a7ab-4ac7047aa3c0
TCGA-17-Z038-01A-01W-0746-08 I 4 JAD 8785c362-1c4d-41da-a29e-
5eff21de2a2e
TCGA-17-Z040-01A-01W-0746-08 LUAD 62d2ca54-b8e0-4907-b75e-cb9786069b52
TCGA-17-Z041-01A-01W-0746-08 LUAD cOead7c7-169e-4932-a987-5461611c95e6
TCGA-17-Z042-01A-01W-0746-08 LUAD 3c303c9d-6cda-490d-a64d-21bc40b064f3
TCGA-17-Z043-01A-01W-0746-08 LUAD 577f7267-c568-4002-a153-26c09d1eca97
TCGA-17-Z044-01A-01W-0746-08 LUAD cblaaeb8-0c6f-4266-968c-38a3823d85f6
TCGA-17-Z045-01A-01W-0746-08 LUAD ec7e65c5-7158-427f-8034-8616077da50b
1CGA-17 Z046 01A 01W 0746 08 LUAD 7aac0e3f-39fe-4c9a-9482-5011)2f1b919d
TCGA-17 Z047 01A 01W 0747 08 LUAD 2c04cfa8-6e99-46fa-82ad-36f096e5ffef
TCGA-17-Z048-01A-01W-0746-08 LUAD 8495e150-796b-4e15-9fa6-11ba558d7b10
TCGA-17-Z049-01A-01W-0746-08 LUAD ac3lbcc6-6ccc-43b7-96f2-3ab47050be76
TCGA-17-Z050-01A-01W-0747-08 LUAD d086dd38-a9e0-466c-ble5-9a4a879abd55
TCGA-17 Z051 01A 01W 0747 OS LUAD 5584878f-0608-45d9-8e28-29c277bf655f
TCGA-17-Z052-01A-01W-0747-08 LUAD af1f7c82-
2a17-4c73-980c-74ec822dc803 ¨
TCGA-17-Z053-01A-01W-0747-08 LUAD 2d422986-6e91-4299-b6cf-4076f3706c83
TCGA-17-Z054-01A-01W-0747-08 LUAD 409dd077-dab9-4f79-9c33-2c3b75b63125
TCGA-17-Z055-01A-01W-0747-08 LUAD de78326d-3afc-4129-af7f-1750da544826
TCGA-17-Z056-01A-01W-0747-08 LUAD e6cb3d63-
5a55-4eba-84d2-a25917c7b1 Se -,
TCGA-17-Z057-01A-01W-0747-08 I 4 JAD 4236905d-1549-4cbc-b3c6-
e62db9ea598b
193

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-17-Z058-01A-01W-0747-08 LUAD 6b0blfca-efce-49d6-9f7b-a2c34bb343e9
TCGA-17-Z059-01A-01W-0747-08 LUAD 88cc6fb4-1681-422c-8204-ef9e8dbf260c
1CGA-17 Z060 01A 01W 0747 OS LUAD f834dfa4-8d9c-4e06-861f-a3cc31245237
TCGA-17 Z061 01A 01W 0747 08 LUAD 1 eb07e6e-6cf8-45e4-965c- I
a9a5d38d117
TCGA-17-Z062-01A-01W-0747-08 T,IJAD 13280e5f-7d6e-4a18-a5a5-
e846805c9e66
TCGA-35-3615-01A LUAD 7407d705-6ec6-4143-93d2-eedcf5a22399
TCGA-35-3621-01A-01D-0969-08 LUAD 4a0cc41a-562c-4aea-a7c3-b1186d46cda8
TCGA-35-4122-01A-01D-1105-08 LUAD 408e1c64-64a8-4801-bf58-3b8183ede851
TCGA-35-4123-01A-01D-1105-08 LI JAD 7ceccaee-df27-4f7f-bfcd-
elc596365711
TCGA-35-5375-01A-01D-1625-08 LUAD 63e76bef-3ef1-445f-b591-649d774729cd
TCGA-38-4625-01A-01D-1553-08 LUAD 6f317d31-c9a4-4345-b5b1-b75776536402
TCGA-38-4626-01A-01D-1553-08 LUAD 85656ce7-6420-433e-a77d-43ef628d685c
TCGA-38 4627 01A OlD 1553 08 LUAD abef97da-d7db-495f-b594-fa66577becd6
TCGA-38 4628 01A OlD 1265 08 LUAD 67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6
TCGA-38-4629-01A-02D-1265-08 LUAD 4797f969-5f4d-4681-9fc5-68f256a8f4d8
TCGA-38-4630-01A-01D-1265-08 LUAD 2b139bb4-5a29-4684-901d-8d966f179ac2
TCGA-38-4631-01A-01D-1753-08 LUAD b3ffc36d-b068-4ada-a00a-b48890c0162c
TCGA-38-4632-01A-01D-1753-08 LUAD 83519ed1-29e2-4f1b-922c-5779f64178bc
TCGA-38-6178-01A-11D-1753-08 LUAD 7fa467fl-d928-4d81-bd0b-68d67a5c18cf
TCGA-44-2655-01A LUAD 9fcabdal-ca79-4188-863f-7d0fd060a819
TCGA-44-2656-01A LUAD 5593f581-3d45-4a4a-a525-bfae1f4753a0
TCGA-44-2657-01A-01D-1105-08 LUAD e3aa9b45-13b9-4b61-a30f-ae3f88466040
TCGA-44-2661-01A-01D-1105-08 I T JAD 3c3a2e7c-9aa0-495e-95c7-
87f66169ed92
TCGA-44-2662-01A LUAD d2198941-e96f-40bd-91be-82886217d5db
TCGA-44-2665-01A LUAD a0863fa6-515c-44fa-825f-f9e243f945f1
TCGA-44-2666-01A LUAD 27a64f32-69c5-4c49-86b4-c8fc923cae08
TCGA-44-2668-01A LUAD dd9a6c68-b8b4-4168-9ff9-72a45f20c44f
TCGA-44-3396-01A-01D-1265-08 LUAD d68b216c-b304-4b30-9af7-eb3a9a1a55ae
TCGA-44 3398 01A OlD 1105 08 LUAD 82284bb3-2dfa-4016-a908-3b5994e00d31
TCGA-44-3918-01A-01D-1105-08 LUAD 7f456c31-58e3-43f1-9176-4422451528a5
TCGA-44-3919-01A LUAD 9de8d353-3442-41d8-8bfe-a08c4975eaca
TCGA-44-4112-01A T,IJAD 6c206676-e511-4281-91f5-bfe91b3279a4
TCGA-44-5643-01A-01D-1625-08 LUAD 44286013-ae97-4890-86d3-1163285ac0cd
TCGA-44-5645-01A-01D-1625-08 LUAD dac33765-0c88-4a51-8389-c042ccb78c83
TCGA-44 6144 01A 11D 1753 08 LUAD 119575fd-eb9d-429f-96ce-c0e8f4bbc593
TCGA-44-6145-01A-11D-1753-08 LUAD 220dc947-
4afc-4485-0cc7-cea046100b4b ¨
TCGA-44 6146 01A 11D 1753 08 LUAD d5e90162-d7d2-4a7c-89f0-51c2b32c9ef0
TCGA-44 6147 01A 11D 1753 08 LUAD 7b6daa70-492c-4283-b3d2-b26f4c26a8d4
TCGA-44-6148-01A-11D-1753-08 LUAD 9c7b3ac8-1352-49cd-8a8c-df6619f6fd64
TCGA-44-6774-01A-21D-1855-08 LUAD f9cc1d71-bece-4693-6953-3e73d1b6c1 lc
TCGA-44-6775-01A-11D-1855-08 I T JAD 7a70a44f-84f3-440a-b898-
dc3a0eff748e
194

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-44 6776 01A 11D 1855 08 LUAD 7d3c5101-fae2-4320-a8a2-a93753375368
TCGA-44 6777 01A 11D 1855 08 LUAD 32a0f0f3-3879-4b96-b9bb-eeab87827f6e
TCGA-44-6778-01A-11D-1855-08 LUAD 903182ad-3145-4fa3-869e-62774aedf86c
TCGA-44 6779 01A 11D 1855 08 LUAD d6990a90-6a99-490b-a476-5298f0c4e4f2
TCGA-49-4486-01A-01D-1265-08 TRIAD 3ac132c3-4889-4dc3-8b3d-Oef98065a858
TCGA-49-4487-01A-21D-1855-08 LUAD 9bd8e303-a8le-4ff8-882b-d46a2f7c55d2
TCGA-49-4488-01A-01D-1753-08 LUAD 3635bb9c-a332-4445-ad81-83cec426dd02
TCGA-49-4490-01A-21D-1855-08 LUAD 940455cf-aa91-432a-bc39-9dfba206e32b
TCGA-49-4494-01A-01D-1265-08 LI JAD 136bc973-1908-4767-9b22-
d43d522b7c71
TCGA-49-4501-01A-01D-1265-08 LUAD 0c53b6lb-5e6f-44a8-97a0-f89d43e0e789
TCGA-49 4505 01A OlD 1265 08 LUAD e773a2fe-1d80-492d-bba8-105036a14a92
TCGA-49-4506-01A-01D-1265-08 LUAD d70718ad-5ea5-493a-a745-9b5dba64f213
TCGA-49-4507-01A-01D-1265-08 LUAD 562a09a1-b491-45c8-a87d-3c2471353c0d
TCGA-49 4510 01A OlD 1265 08 LUAD b2c12bff-addd-45a2-ada4-c30ac935809c
TCGA-49-4512-01A-21D-1855-08 LUAD fa6a60f5-8949-4e01-9435-d3117601627f
TCGA-49-4514-01A-21D-1855-08 LUAD 7751af67-1415-475e-8ec5-66d76f515014
TCGA-49-6742-01A-11D-1855-08 LUAD 49dec0c2-8e75-4f44-a253-82b2ea605890
TCGA-49-6743-01A-11D-1855-08 LUAD 545c9d29-a8e0-4d2d-8552-c127b46f96070
TCGA-49 6744 01A 11D 1855 08 LUAD bf6ba698-7154-4d7f-b076-24ac2f768696
TCGA-49-6745-01A-11D-1855-08 LUAD bfb97048-977b-4722-be8f-3dd37370ba30
TCGA-49-6767-01A-11D-1855-08 LUAD 9f82f494-042a-4f00-954c-4761fa25b298
TCGA-50-5044-01A-21D-1855-08 LUAD ec034986-4bf7-4554-b635-ca6d9c30da28
TCGA-50-5045-01A-01D-1625-08 I J JAD b0d734ad-1222-4bc04)02b-
ld2262b8ac35
TCGA-50 5049 01A OlD 1625 08 LUAD 96358297-0735-4eab-a01c-a6be5d86a3de
TCGA-50-5051-01A-21D-1855-08 LUAD bb50bc27-fb18-4eee-8785-b8e8b69bcbe6
TCGA-50-5055-01A-01D-1625-08 LUAD 12fe153e-a8f7-49ec-9e0c-f680e2311cf6
TCGA-50-5066-01A-01D-1625-08 LUAD f5a97315-1906-4774-980e-0879c6ad368e
TCGA-50-5068-01A-01D-1625-08 LUAD clefdc48-6ea5-45f0-9fa3-94c42ecf3ab4
TCGA-50-5072-01A-21D-1855-08 LUAD 3c6dcba5-1312-40ca-b589-07f7d88b3477
TCGA-50 5930 01A 11D 1753 08 LUAD bd3e88b3-b37c-4641-85fa-d8125ba324ca
TCGA-50 5931 01A 11D 1753 08 LUAD 290847c6-c9d4-4a16-a70f-0488e3718f35
TCGA-50-5932-01A-11D-1753-08 LUAD 6726c157-f688-491d-8b56-35628645df89
TCGA-50-5933-01A-11D-1753-08 LUAD cc3 a9cfe-8a14-4fb4-a60f-3ec795c5d7
al
TCGA-50 5935 01A 11D 1753 08 LUAD 9570cd02-3339-4805-855a-74ebe429df96
TCGA-50 5936 01A 11D 1625 08 LUAD 82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08
TCGA-50-5939-01A-11D-1625-08 LUAD aa9108d7-5036-4059-ad82-dc64161d5bc3
TCGA-50 5941 01A 11D 1753 08 LUAD 86ef12c0-d5fc-4852-9960-593366e717b4
TCGA-50-5942-01A-21D-1753-08 T,IJAD 95475c1b-086d-4e09-a871-47d8176c1
a07
TCGA-50 5944 01A 11D 1753 08 LUAD a314ee0c-694b-4ac8-b572-ff1fbbda4765
TCGA-50-5946-01A-11D-1753-08 LUAD 142d43e8-10e1-4945-a37c42824d53b122
TCGA-50-6590-01A-12D-1855-08 LUAD 85de182b-f4ae-41e6-63fb-f60f46c072e4
195

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-50-6591-01A-11D-1753-08 LUAD bf7462a2-394f-4838-bcb6-4d0126fa48b1
TCGA-50-6592-01A-11D-1753-08 LUAD d0303d05-a937-4a7d-9934-ffa93cc1c5dc
1CGA-50 6593 01A 11D 1753 08 LUAD 10e03053-f6e3-4267-8638-ce58c6e7dfaa
TCGA-50 6594 01A 11D 1753 08 LUAD e1365c7d-e93e-4478-a8e9-ae2d7ca30bc6
TCGA-50-6595-01A-12D-1855-08 LUAD 9913e506-fc98-467d-8601-89595d0475e8
TCGA-50 6597 01A 11D 1855 08 LUAD cd0aeed5-93a1-4287-8a88-fe6b7b5e3983
TCGA-55-1592-01A LUAD e190a9e4-10ae-4060-a071-4b8b73479023
TCGA-55-1594-01A LUAD 2885d4b3-34a6-421d-b20c-eedad721d10a
TCGA-55-1595-01A-01D-0969-08 LI JAD flbe8e08-5201-4966-abf7-
cedcOeff06d6
TCGA-55-1596-01A LUAD 9a7a1b22-9df6-438f-ad00-54755c7d6c7c
TCGA-55 5899 01A 11D 1625 08 LUAD ddaf36f7-7503-4ab4-b7f5-9777c0c1518c
1CGA-55-6543-01A-11D-1753-08 LUAD ac7ab3b3-eb76-4da9-151153-
821590c8d79d6
TCGA-55-6642-01A-11D-1855-08 LUAD 3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf
TCGA-55 6712 01A 11D 1855 08 LUAD bc6eaf26-9ccc-4ac7-9619-204b0ff420a3
TCGA-64-1676-01A LUAD 4bdf77d2-33cc-46e0-af34-1e66a90a213a
TCGA-64-1677-01A-01W-0928-08 LUAD 559017d8-4b22-4313-abdd-d3526c889d7f
TCGA-64 1678 01A 01W 0928 08 LUAD 42e3b592-657f-4b18-8f62-e7b0a9c0f1d6
TCGA-64-1680-01A LUAD 0bd6e623-c195-465a-917d-87dfb6a8618e
TCGA-64-5774-01A-01D-1625-08 LUAD df5957d5-20d3-483e-990b-d63691b99068
TCGA-64-5775-01A-01D-1625-08 LUAD c209d392-7d3a-481c-8cc7-398a6b90290a
TCGA-64-5778-01A-01D-1625-08 LUAD 3c540f87-5981-467a-blab-30c2056c785e
TCGA-64 5779 01A OlD 1625 08 LUAD 5734711b-52cd-46e6-9c2a-92c0612fee33
TCGA-64-5781-01A-01D-1625-08 I T LAD fb9cf649-99cf-4f49-8f3d-
e25e762eb3ce
TCGA-64 5815 01A OlD 1625 08 LUAD e800c8d4-786a-4a9d-ace2-26779336e557
TCGA-67-3770-01A LUAD 74bcf2d5-fd42-423e-bd96452de1b0cf778
TCGA-67-3771-01A LUAD 60410cd6-693d-41d6-9dad-d1b1c306f5cb
TCGA-67-3772-01A-01W-0928-08 LUAD 09226bc4-0202-4405-b3c9-208e8ffb7408
TCGA-67-3773-01A LUAD e4c666f4-e847-406f-af14-20a3867a1c35
TCGA-67-3774-01A LUAD 63585415-9ab9-4614-8b15-8edb66efdldc
1CGA-67 4679 0113 OIL) 1753 08 LUAD 3416121e-abd5-498e-8c49-111782a1842c
TCGA-67 6215 01A 11D 1753 08 LUAD 68c2a355-862c-4657-6296-5776ed844760
TCGA-67-6216-01A-11D-1753-08 LUAD 6dc6da8c-2ecf-4121-62c4-74529adb7cOf
TCGA-67 6217 01A 11D 1753 08 LUAD cb98d825-668f-4b16-a05e-501e1c94f3fe
TCGA-71-6725-01A-11D-1855-08 LUAD 3a146eb4-7b9b-4834-b3d0-eac80f9173ec
TCGA-73 4658 01A OlD 1753 08 LUAD 611151cf-6976-4812-a77e-1a12f9d1245c
TCGA-73-4659-01A-01D-1265-08 LUAD 13989aec-
bla3-47c2-bc8e-ccf55f8e0c11 ¨
TCGA-73-4662-01A-01D-1265-08 LUAD 48262c89-ecac-44c6-9a06-717067641058
TCGA-73-4666-01A-01D-1265-08 LUAD f49fc77e-03cd-423c-b3e1-18bb19568650
TCGA-73-4668-01A-01D-1265-08 LUAD Ofdcb5e9-ada2-4755-ae02-491037ee9c10
TCGA-73-4670-01A-01D-1265-08 LUAD 2aea0652-
17ae-4dfa-9358-206d4f24f02f -,
TCGA-73-4675-01A-01D-1265-08 I T LAD 59dad620-51f8-4c12-8609-
e6351bde126e
196

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-73-4676-01A-01D-1753-08 LUAD ff368c6d-fedb-49cc-b519-7726816aff8d
TCGA-73 4677 01A OlD 1265 08 LUAD a9c03165-d534-425e-8370-d1f557b82fa2
1CGA-75-5122-01A-01D-1753-08 LUAD e359b24f-7312-432f-b054-68dedc027df2
TCGA-75 5125 01A OlD 1753 08 LUAD 4cee9575-3040-4ffl-bf7e-ca8873860c59
TCGA-75-5126-01A-01D-1753-08 T,IJAD lel ad138-a59e-4f5d-8382-
54c585c9298c
TCGA-75 5146 01A OlD 1625 08 LUAD 965a2bb7-6cd4-4309-beba-51ae74b8a980
TCGA-75-5147-01A-01D-1625-08 LUAD 52910a60-bb15-4ba5-9d09-50d8ee6a445b
TCGA-75-6203-01A-11D-1753-08 LUAD d9cd7f95-07d3-4b87-be83-87340b08d249
1CGA-75-6205-01A-11D-1753-08 LUAD 79c0e183-95aa-4c37-9b15-8567aa87c93a
TCGA-75 6206 01A 11D 1753 08 LUAD 7a5ca299-85d3-46b1-a710-6dcd3ce821c8
TCGA-75 6207 01A 11D 1753 08 LUAD 5a49e3fd-a47d-4b7d-9485-4238a88f4516
TCGA-75 6211 01A 11D 1753 08 LUAD d8c9abbe-b112-4019-a6a3-f582df1379ed
TCGA-75-6212-01A-11D-1753-08 LUAD 0f2af4c9-05a8-4c97-ac2d-af9241b4ea64
TCGA-80-5611-01A-01D-1625-08 LUAD c9bab512-c5c3-4ad3-a9bf-f5258e405966
TCGA-86-6562-01A-11D-1753-08 I,IJAD e48dd1lb-89ae-4278-8de0-
7956423c8609
TCGA-91-6828-01A-11D-1855-08 LUAD 99f819f2-4340-4303-8ff0-fdb03ef0151a
TCGA-91-6829-01A-21D-1855-08 LUAD 443f5b2d-832e-45cf-bca5-3f064ea3bc50
TCGA-91 6831 01A 11D 1855 08 LUAD 1624af6f-05a6-474c-ba49-9754938979c6
TCGA-91-6835-01A-11D-1855-08 LUAD 8120c5eb-2917-4053-a5e5-aad53ff45da9
TCGA-91-6836-01A-21D-1855-08 LUAD 87045814-366d-4e42-97f2-a1341c620c47
TCGA-18 3406 01A OlD 0983 08 LUSC d3320989-71fd-425b-933e-6e8528a016ed
TCGA-18 3407 01A OlD 0983 08 LUSC c5b09119-0237-4804-a4f9-b67d676b8674
TCGA-18-3408-01A-01D-0983-08 LUSC cab7a425-e081-413ae-b666-6cdf8ba4dd70
TCGA-18-3409-01A-01D-0983-08 II JSC aa733cb0-37a9-4fef-8d40-
d57596ce9e51
TCGA-18-3410-01A-01D-0983-08 LUSC 7e6382c3-368a-43a5-9812-c58f54ceba3f
TCGA-18 3411 01A OlD 0983 08 LUSC 6a9cc303-c7fd-4f40-8933-1636dea99252
TCGA-18-3412-01A-01D-0983-08 I ,USC 84aca315-8380-4625-887f-
a8b3c704c0a9
TCGA-18-3414-01A-01D-0983-08 LUSC 239deee9-2791-4163-b777-fdf8c49c9e33
TCGA-18 3415 01A OlD 0983 08 LUSC ad0365d1-10b1-41e6-b838-9c5794b9ad42
TCGA-18-3416-01A-01D-0983-08 LUSC e03577e7-37be-460b-96e8-5f6e0b49b3aa
TCGA-18 3417 01A OlD 1441 08 LUSC 024d8a82-06c5-4b82-9a27-c52bc4fd450a
TCGA-18 3419 01A OlD 0983 08 LUSC c75ed357-d845-4443-8c9e-a2afa8ed30df
TCGA-18-3421-01A-01D-0983-08 LUSC 9f0e482e-e72d-4c57-b4f7-4580edabd390
TCGA-18-4083-01A-01D-1352-08 LUSC Ob87a82d-096c-4dd7-80c4-b4054fc1eba2
TCGA-18-4086-01A-01D-1352-08 LUSC 9bbdf36b-6804-416f-977d-fce772972bcc
TCGA-18-4721-01A-01D-1441-08 LUSC d2ab2555-7288-47a4-a80c-bf62d65b67b8
TCGA-18-5592-01A-01D-1632-08 LUSC 1a6da454-8faf-4725-a702-55d29da461a5
TCGA-18-5595-01A-01D-1632-08 T,IJSC 97398ed8-2295-411)0-
985744433dfc785a
TCGA-21 1070 01A OlD 1521 08 LUSC 9e300205-b16d-4f40-bflb-f47410678f6d
TCGA-21-1071-01A-01D-1521-08 LUSC e0130219-c5d6-4745-9c5d-d8bb8d278a77
TCGA-21-1076-01A-02D-1521-08 LUSC 504d4cb0-d2dd-420d-82e6-9ec14434a0fc
197

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-21 1077 01A OlD 1521 08 LUSC a71d74cb-5010-4787-a654-7049cbb49a92
TCGA-21 1078 01A OlD 1521 08 LUSC 8cf9b32d-3d6f-4898-8c7a-89511b754021
TCGA-21-1081-01A-01D-1521-08 LUSC 81117a11-635c-4606-91fd-3729b97ffd8e
TCGA-21-5782-01A-01D-1632-08 LUSC 4c2ad4a0-5d57-4e27-9f35-058021205f50
TCGA-21-5784-01A-01D-1632-08 T,IJSC 179285af-c364-4ec3-97d3-
70a7d9b5800b
TCGA-21-5786-01A-01D-1632-08 LUSC d7404e0f-d171-419b-97d3-807570aba129
TCGA-21-5787-01A-01D-1632-08 LUSC 7cb79e4b-c1f1-434d-b13b-6c2eb7760ee8
TCGA-22-0944-01A-01D-1521-08 LUSC 818a6f09-a7fd-4ece-8373-adb4bcb5bc8c
TCGA-22-1002-01A-01D-1521-08 I,IJSC 7c7604fe-8321-46cb-ac34-0e79941i
8853b
TCGA-22 1011 01A OlD 1521 08 LUSC c992419f-fd86-434c-a83d-393d65272e64
TCGA-22 1012 01A OlD 1521 08 LUSC 3b75368a-d57f-4787-a0ef-3f478e7d22bc
TCGA-22-1016-01A-01D-1521-08 LUSC 935b113e-f5ed-4a07-8eld-1603daba7f40
TCGA-22-4591-01A-01D-1267-08 LUSC bcfb93d4-8653-477b-05d2-c2832a0e3d92
TCGA-22-4593-01A-21D-1817-08 LUSC b4a48075-921I1-43ab-95f3-476bcea88d7b
TCGA-22-4595-01A-01D-1267-08 LUSC 7fcf5123-2d1b-4666-9d39-alaaf63cf954
TCGA-22 4599 01A OlD 1441 08 LUSC 08732b51-8ee8-4888-b0e8-a0eb83181cb9
TCGA-22 4601 01A OlD 1441 08 LUSC 6c05b315-65e9-4e7d-9f99-a694006f2ed0
TCGA-22-4604-01A-01D-1267-08 LUSC db26141b-109c-4cel-af4e-f648a0d4171b
TCGA-22-4607-01A-01D-1267-08 LUSC d8c6bb83-ebdd-4547-9077-3eba5c8bb9f0
TCGA-22 4613 01A OlD 1441 08 LUSC 5d1d538a-57d3-42ec-9fa3-0fad10b0f52f
TCGA-22 5471 01A OlD 1632 08 LUSC 665e98bf-6163-4d18-9665-ba93df9ecf6d
TCGA-22-5472-01A-01D-1632-08 LUSC be780766-483f-42f5-b0d0-11d23a940156
TCGA-22-5473-01A-01D-1632-08 LUSC c107cald-5e35-470a-8c39-80dc7624e306
TCGA-22-5474-01A-01D-1632-08 LUSC leda33fc-80e5-4c5f-8c61-43976ca0106f
TCGA-22-5477-01A-01D-1632-08 LUSC e7ebc6fb-0926-4c8 a-a67b-Oc6b9c1ffab
a
TCGA-22-5478-01A-01D-1632-08 LUSC Oac704eb-d722-4c27-b194-fea6ca7af240
TCGA-22-5480-01A-01D-1632-08 LUSC 24e426fb-219a-4a4d-a45c-c9b0896d0e88
TCGA-22-5482-01A-01D-1632-08 LUSC b57c316e-lcae-4286-bdbb-8b65e020b3fa
TCGA-22-5485-01A-01D-1632-08 LUSC 448af8b4-e071-48b0-a65b-b4ad17 afdc0c
TCGA-22-5489-01A-01D-1632-08 11 JSC c4eb6681-7ec3-4688-1106a-
c47a0043f3fh
TCGA-22-5491-01A-01D-1632-08 LUSC ed4b5a8c- ldae-41 a3-8a2a-f54fa5lbe4b
8
TCGA-22-5492-01A-01D-1632-08 LUSC abc94013-71f5-4ac6-88a4-01b4ef9f9d2f
TCGA-33-4532-01A-01D-1267-08 LUSC c8baeba2-2a73-41d7-9226-b89a8f42e 18f
TCGA-33-4533-01A-01D-1267-08 LUSC 52b8c7c1-2cfe-410d-a738-1dec43109e24
TCGA-33-4538-01A-01D-1267-08 LUSC e04814f8-a51f-4b6b-a4e9-bd8d2291817c
TCGA-33-4547-01A-01D-1267-08 LUSC 7e622fc2-06c5-4686-a885-e407725c2f08
TCGA-33 4566 01A OlD 1441 08 LUSC ddd84ea3-dd5e-4195-97c3-84c107c19ead
TCGA-33-4582-01A-01D-1441-08 LUSC 4cb06585-62f9-4aae-969a-2085b4d514c3
TCGA-33-4583-01A-01D-1441-08 I JSC fb901997-6e46-436f-ad34-74aadc344245
TCGA-33 4586 01A OlD 1441 08 LUSC e6bf4288-9fdd-4c56-b6d2-fa2f5ee542b6
TCGA-33-6737-01A-11D-1817-08 LUSC 3b2 lce38-16c6-4c68-9104-fal 1f1b619b
1
198

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-34-2596-01A-01D-1522-08 LUSC 66e35f68-f4db-46ee-876e-e770ea616ef3
TCGA-34-2600-01A-01D-1522-08 LUSC 167e0f4e-e7d3-4942-885a-cf06419bbe6d
1CGA-34-2608-01A-02D-1522-08 LUSC 3c902096-66f6-40b2-a374-6cd37d6d3895
TCGA-34-5231-01A-21D-1817-08 LUSC c9862ed2-49a6-434d-a205-b 1bda292d218
TCGA-34-5232-01A-21D-1817-08 LUSC 1321ff2f-Obbf-475 f-b088-3f1699203c31
TCGA-34-5234-01A-01D-1632-08 LUSC 7b19ae84-2cab-47e7-87df-46c497da17e0
TCGA-34-5236-01A-21D-1817-08 LUSC 46cb2de7-bbel-4444-b17e-4c5677a05249
TCGA-34-5239-01A-21D-1817-08 LUSC 6e596912-2146-4c4f-97b6-70b610f5d4b4
TCGA-34-5240-01A-01D-1441-08 LUSC 4c3840df-9824-40db-879e-6d24adc8c155
TCGA-34 5241 01A OlD 1441 08 LUSC Obcdbc37-cde8-47df-9184-621b2047da5b
TCGA-34-5927-01A-11D-1817-08 LUSC d717b13a-e487-4cad-9aae-4b0d649236c4
TCGA-34-5928-01A-11D-1817-08 LUSC 9e2d032e-f982-44fc-b6e0-36e82f029689
TCGA-34-5929-01A-11D-1817-08 LUSC a25de54e-cl3d-4973-864a-e307fbe7324a
TCGA-37 3783 01A OlD 1267 08 LUSC 711e9b21-bd8c-4058-a0ce-5ff4dc23b527
TCGA-37 3789 01A OlD 0983 08 LUSC d732196f-ef85-43ea-aac7-7c90606119c5
TCGA-37-4133-01A-01D-1352-08 LUSC a678cc49-9009-4027-826f-e17f4533538d
TCGA-37-4135-01A-01D-1352-08 LUSC 754dda66-fceb-4163-bc99-c98aaa86b0c2
TCGA-37-4141-01A-02D-1352-08 LUSC 3d4f4555-d71a-4c7d-8667-c42dcc20c076
TCGA-37-5819-01A-01D-1632-08 LUSC edf2a2c0-3829-4da2-8960-598fbd5c4c07
TCGA-39 5016 01A OlD 1441 08 LUSC d63a0a46-7676-40f5-8e03-b8317d243c73
TCGA-39-5019-01A-01D-1817-08 LUSC 6aecd71e-84f1-464d-bff6-ede33026f586
TCGA-39-5021-01A-01D-1441-08 LUSC 4d804c6f-e6eb-4799-b64d-119afc691e3d
TCGA-39-5022-01A-21D-1817-08 IT JSC 160928ab-0cb1-4483-8d61-48a5333defb
f
TCGA-39-5024-01A-21D-1817-08 LUSC 388478e9-8c1f-43f8-88c4-811bf3cc2500
TCGA-39-5027-01A-21D-1817-08 , LUSC , 32c14926-b510-4714-90b2-
bObd68569cd4
TCGA-39-5028-01A-01D-1441-08 LUSC 015b9329-ecf2-4410-b7b6-f9313b5d2adb
TCGA-39 5029 01A OlD 1441 08 LUSC aa02083c-7e10-400d-bd8d-729dacda6352
TCGA-39 5030 01A OlD 1441 08 LUSC 9e7b6312-6080-4bb0-045d-a0d4Odffcbe0
TCGA-39 5031 01A OlD 1441 08 LUSC 3cab4096-8e8e-459d-a2bb-6ef03f414315
TCGA-39 5035 01A OlD 1441 08 LUSC 035fe73e-56b4-4afe-b70e-dd3c34027f2d
TCGA-39 5036 01A OlD 1441 08 LUSC al aa5fba-f179-4777-8d49-345a366d12fa
TCGA-39-5037-01A-01D-1441-08 T,IJSC 8250d82c-f8f8-4776-a715-713b3a574955
TCGA-39 5039 01A OlD 1441 08 LUSC Oc14e914-abd4-4406-be82-a810b10a1320
TCGA-43-2578-01A-01D-1522-08 LUSC 7ce90b30-d372-4edb-9807-b71cb5eb4cb7
TCGA-43 3394 01A OlD 0983 08 LUSC bb72e789-18ad-4a65-805b-a9ac2Icef0e3
TCGA-43-3920-01A-01D-0983-08 LUSC a9733314-
c1289-493f-8dff-88e527191a86 ¨
TCGA-43-5668-01A-01D-1632-08 LUSC fOldfe80-aee9-44f6-b32d-3591fbc3c0f5
TCGA-43-6143-01A-11D-1817-08 LUSC 3874253f-7168-4cd6-b1d64426fa207313
TCGA-43-6647-01A-11D-1817-08 LUSC 90b9794-8-26f7-4431-be89-af8c432baae0
TCGA-43-6770-01A-11D-1817-08 LUSC 404ca8c24166-4749-8abd-87f491a8111c
TCGA-43-6771-01A-11D-1817-08 I 4 JSC 20735861-1 f84-4141-a467-
1598108e1e41
199

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-46-3765-01A-01D-0983-08 LUSC 6c4bb09f-46c8-4a42-bf4f-8bad5316603d
TCGA-46-3766-01A-01D-0983-08 LUSC 0a691892-2209-4f3c-ab16-c2560c4928b4
1CGA-46 3767 01A OlD 0983 08 LUSC db4ea3ec-e926-4e75-a97b-a527c1016369
TCGA-46 3768 01A OlD 0983 08 LUSC 30666313-cc29-4fce-8308-b04fb932083c
TCGA-46-3769-01A-01D-0983-08 LUSC 108a1360-a545-4573-a775-49b3420814e2
TCGA-46-6025-01A-11D-1817-08 LUSC 767a9ae0-2aa4-467b-b9c3-fb3bf701b642
TCGA-46-6026-01A-11D-1817-08 LUSC 42a4a60c-257e-4bf6-a9ba-6f162dbca94a
TCGA-51 4079 01A OlD 1458 08 LUSC 0a43aade-225c-4a29-b1d8-6b930eb8a1db
TCGA-51-4080-01A-01D-1458-08 LUSC 2498ada2-b8d3-4220-8283-45af67a8119a
TCGA-51 4081 01A OlD 1458 08 LUSC 1492c429-1041-4d86-9358-c9b9babd1401
TCGA-56 1622 01A OlD 1521 08 LUSC 0bbc7ede-5022-4084-925c-d65baaf7abc2
TCGA-56-5897-01A-11D-1632-08 LUSC 056acb55-f3ba-4ce0-9735-3cfe6516df55
TCGA-56-5898-01A-11D-1632-08 LUSC aaf47efe-4a0a-40d1-070f-9c9168cbdae0
TCGA-56 6545 01A 11D 1817 08 LUSC 16756a08-8308-4ad3-9e21-2cea0cd7028e
TCGA-56-6546-01A-11D-1817-08 LUSC 87e71949-5bd9-458c-95f7-4b19882c2b4f
TCGA-60-2698-01A-01D-1522-08 LUSC 2045c788-9ea8-4ea5-a5e3-65fc16a62adb
TCGA-60-2707-01A-01D-1522-08 LUSC 5d1fa470-2789-4576-9743-0362af682c1d
TCGA-60-2708-01A-01D-1522-08 LUSC a371189b-5808-4408-824e-8dacec925cc5
TCGA-60-2709-01A-21D-1817-08 LUSC 4f321c92-ae27-4253-bd80-4505ba8c7dc4
TCGA-60-2710-01A-01D-1522-08 LUSC faecblfe-b4cf-434d-818c-81ad2167dd25
TCGA-60-2711-01A-01D-1522-08 LUSC 2ed85cc9-31bc-4cea-9e54-13b7c0e645fa
TCGA-60-2712-01A-01D-1522-08 LUSC 6662dd1b-3e4f-4b7a-b603-cfa7fd92fc30
TCGA-60-2713-01A-01D-1522-08 I T JSC 79eb70ba-f0d8-462c-add7-
20a2167843e1
TCGA-60-2715-01A-01D-1522-08 LUSC 8e05a30d-2177-45e0-90fd-8c5961268c39
TCGA-60-2719-01A-01D-1522-08 LUSC ee6cc68e-8d2a-41cc-82c6-0fecd17e6259
TCGA-60-2720-01A-01D-1522-08 LUSC 3b435ddf-a496-40a2-82e8-6b10391aae5d
TCGA-60-2721-01A-01D-1522-08 LUSC 8defff62-9395-47cb-bb19-4b8487d9ea8e
TCGA-60-2722-01A-01D-1522-08 LUSC eb955f72-83bf-4635-a7ed-89e4d66e08f4
TCGA-60-2723-01A-01D-1522-08 LUSC 8a6aa45a-cf6d-4005-b7c9-e15240dc6dd4
TCGA-60-2724-01A-01D-1522-08 LUSC 387c6519-6529-4074-a5ab-00f8052a5732
TCGA-60-2725-01A-01D-1267-08 LUSC f3ed705b-e5aa-4756-9794-e4b85303693a
TCGA-60-2726-01A-01D-1522-08 LUSC a96eddfc-3af0-4148-a440-c917781131bd
TCGA-63 5128 01A OlD 1441 08 LUSC d3b9b51e-eeea-4355-829d-ee35bdd2cf5b
TCGA-63 5131 01A OlD 1441 08 LUSC b290a86e-22da-4f10-a421-2616bb47bc1b
TCGA-63-6202-01A-11D-1817-08 LUSC a3c568a6-0c43-47a7-a35a-3225fedeeb44
TCGA-66-2727-01A-01D-0983-08 LUSC c2b2c909-
1461-42ce-8fd9-736147dcacd8 ¨
TCGA-66-2734-01A-01D-0983-08 LUSC 9f7a24a2-10e2-4039-ad27-13d7ec28ff36
TCGA-66-2742-01A-01D-0983-08 LUSC 07047a99-45bd-4df6-ad6f-934a48e8c213
TCGA-66-2744-01A-01D-0983-08 LUSC 43be1 a37-b 18e-4e96-89e6-ed6ee1d8e65
a
TCGA-66-2754-01A-01D-0983-08 LUSC c34a64c8-3746-44N-a7ee-77f50266256c
TCGA-66-2755-01A-01D-1522-08 I T JSC 177d64a9-65dc-4aa1-8774-
bd8208e40f04
200

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-66-2756-01A-01D-1522-08 LUSC 472c95e6-eccb-4988-be16-fdace73b2ed8
TCGA-66-2757-01A-01D-1522-08 LUSC 1886dba0-4662-4342-84ac-96af0beb2393
1CGA-66-2758-01A-02D-1522-08 LUSC 71c4e854-a704-4787-a37a-fa6642ca5dac
TCGA-66-2759-01A-01D-1522-08 LUSC fecd0a2b-d176-438a-be95-306f453fde40
TCGA-66-2763-01A-01D-1522-08 T,IJSC d6493c56-5322-4961-a693-
8e8a62b0f7f1
TCGA-66-2765-01A-01D-1522-08 LUSC 85d7e094-ca96-4090-83aa-2f318ae6e954
TCGA-66-2766-01A-01D-1522-08 LUSC 452b75d0-1818-46aa-8804-9cfc0bd664-49
TCGA-66-2767-01A-01D-1522-08 LUSC ca748128-272c-4fad-9alf-01328b93b3f4
TCGA-66-2768-01A-01D-1522-08 HNC 5d458cef-965d-4d27-b754-31df67ed6eaa
TCGA-66-2770-01A-01D-1522-08 LUSC e417903d-ab76-44f0-aae9-3a91fa9a8d3c
TCGA-66-2771-01A-01D-0983-08 LUSC 58c73372-223f-400a-a2df-073a78c58b62
TCGA-66-2773-01A-01D-1267-08 LUSC tb0b515b-afc4-40c3-abe6-e90c442f0249
TCGA-66-2777-01A-01D-1267-08 LUSC 2ea52fb8-d7c9-48ce-9aef-50df7c42e5d5
TCGA-66-2778-01A-02D-1522-08 LUSC 5215060d-5ffd-49f3-a7a7-73167e7af74a
TCGA-66-2780-01A-01D-1522-08 LUSC d088bd17-ala0-4bd9-bfel-d57b5725c53b
TCGA-66-2781-01A-01D-1522-08 LUSC bfb33630-c8a8-4ec4-9eee-8bef349339ea
TCGA-66-2782-01A-01D-1522-08 LUSC 640ff507-203c-45aa-8bc1-030ee8639b5d
TCGA-66-2783-01A-01D-1267-08 LUSC f574d3b7-4ae4-49bc-9e05-f965tbc86119
TCGA-66-2785-01A-01D-1522-08 LUSC 57debe39-f57d-400a-a860-3de357d6bee1
TCGA-66-2786-01A-01D-1522-08 LUSC 999a6582-33cf-47ca-b268-9b2da102e99b
1CGA-66-2787-01A-01D-0983-08 LUSC c59e5971-e243-4b00-b5f0-f4bca18530d6
TCGA-66-2788-01A-01D-0983-08 LUSC 2466d424-98bb-4380-9967-36abaa0e69d7
TCGA-66-2789-01A-01D-0983-08 I J JSC fab8faeb-35b3-42f0-bOaf-
4dfb1325a21a
TCGA-66-2791-01A-01D-0983-08 LUSC dd468431-2fa4-45ab-belf-90671891c5c4
TCGA-66-2792-01A-01D-0983-08 LUSC b704a17a-9ee9-4555-b2bb-250ac1ec5bed
TCGA-66-2793-01A-01D-1267-08 LUSC 7dc5f8ba-0080-43d3-8426-bd527a970761
TCGA-66-2794-01A-01D-1267-08 LUSC 2c58fa70-8fef-4a49-8cde-bfdc92e77919
TCGA-66-2795-01A-02D-0983-08 LUSC 73825564-8731-4137-972a-330490aceadc
TCGA-66-2800-01A-01D-1267-08 LUSC 803ec3a5-4347-41c3-a7b6-7eb00427a48c
TCGA-70-6722-01A-11D-1817-08 LUSC e81flbb5-2d06-44b3-998a-e7a0b818467c
TCGA-70-6723-01A-11D-1817-08 LUSC 7483ea9f-8587-41e7-9ae5-d9223b76f33e
TCGA-85-6175-01A-11D-1817-08 T,IJSC 2ba53bf0-a4e1-41)46-1)258-
610522aac7ee
TCGA-85-6560-01A-11D-1817-08 LUSC a5a156b8-2c8a-4ed0-8bae-b60cdc95698f
TCGA-85-6561-01A-11D-1817-08 LUSC f5aa0fle-da19-4c04-b695-01ed5b20e79e
TCGA-04-1332-01A-01W-0488-09 OV b52e5d90-dc57-438c-9c38-e043308c24ac
TCGA-04 1336 01A 01W 0488 09 OV 586101df-
93c9-4d0b-ba0e-58df7a2f9598 _
TCGA-04 1343 01A 01W 0488 09 OV fbbc3d80-aff2-463e-8eb3-c4361ad7cb98
TCGA-04-1346-01A-01W-0488-09 OV 9f494d17464f-4935-ae42-eeb0994624dc
TCGA-04 1347 01A 01W 0488 09 OV 21b50b8c-781a-4e15-a4ad-715f416f0fa2
TCGA-04 1348 01A 01W 0494 09 OV 1t4dee42-8t3d-4307-b6e5-3381d77d201c
TCGA-04 1349 01A 01W 0494 09 OV e456f707-f0a0-4624-98bc-e9dfe779182b
201

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-04 1361 01A 01W 0494 09 OV 0fc567bd-2201-4f3d-820e-2c0dbe58da6f
TCGA-04 1362 01A 01W 0494 09 OV 830e207f-458e-4628-b7bc-287c2f2e12e5
1CGA-04-1542-01A-01W-0553-09 OV 317a63at-e862-43df-8ef5-7c555b2cb678
TCGA-09-0366-01A-01W-0372-09 OV 62269d21-50de-42b0-b1e4-75ed8010080a
TCGA-09-0369-01A-01W-0372-09 OV 633f5c4d-e224-404c-9f68-24daafd11c84
TCGA-10-0930-01A-02W-0421-09 OV ec98ed86-1d2f-4e54-b2d4-5976469bf0b8
TCGA-10-0933-01A-01W-0421-09 OV 3ee4215f-b57d-4ae7-b247-55ea1f7e97d3
TCGA-10-0935-01A-03W-0421-09 OV af0edbf4-9d90-4373-a9ce-0875ebbe1d04
1CGA-13-0723-01A-02W-0372-09 OV 6f9e5a76-5d2a-4bb0-babf-3f365a177236
TCGA-13-0724-01A-01W-0372-09 OV 2b6aa1c8-5150-4d8f-af59-d5a826321308
TCGA-13-0726-01A-01W-0372-09 OV 201415c2-5b5a-4bb8-8005-bf2c78d4d88e
TCGA-13-0755-01A-01W-0372-09 OV 9bd227fa-e52a-4805-bd04-ad63df0930af
TCGA-13-0760-01A-01W-0372-09 OV 5181630f-246a-4cb4-88c2-1534b5fb8e37
TCGA-13-0765-01A-01W-0372-09 OV 5bcfe3ea-d95e-47ff-9718-61)123d3acaef
TCGA-13-0791-01A-01W-0372-09 OV 70f63e2f-9be6-4ed9-8d91-f1889287d7b7
TCGA-13-0795-01A-01W-0372-09 OV b266a007-694a-4580-ad67-48b0f709bc43
TCGA-13-0800-01A-01W-0372-09 OV 757862e3-0392-4e05-a242-25e3d2094ee8
TCGA-13-0804-01A-01W-0372-09 OV 7f39610d-45b8-45ae-806e-16b7acebata6
TCGA-13-0807-01B-02W-0421-09 OV f80466d9-6cc8-461b-acc2-addee22bd42a
TCGA-13 0884 01B 01W 0494 09 OV c5f0aa38-556b-401c-b4da-ac82ede2e637
TCGA-13-0885-01A-02W-0421-09 OV a530d9a9-b2le-47be-b4d8-1707b71f360a
TCGA-13-0887-01A-01W-0421-09 OV e0514612-688d-416b-a992-e2c7a2b7b244
TCGA-13 0890 01A 01W 0421 09 OV 15b86711)-7a7b-4158-9abd-91870ba77eb7
TCGA-13-0893-01B-01W-0494-09 OV a335ab49-84b7-4d3b-a03d-9c3931904ca5
TCGA-13 0894 01B 01W 0494 09 OV eb57990e-702f-4fac-9ef5-7447ecb45cec
TCGA-13-0897-01A-01W-0421-09 OV f48ed68f-a833-4b78-971a-3c746c563d24
rfCGA-13-0903-01A-01W-0421-09 ()V 854167b5-03ab-4867-af34-9c92e385822e
TCGA-13-0910-01A-01W-0421-09 OV 26cebe0b-b7a7-431e-bc12-7fda22af72f3
TCGA-13-0912-01A-01W-0421-09 OV 517f4d7f-c962-414f-8824-f2a7ae19cb6d
TCGA-13-0920-01A-01W-0421-09 OV 2e28969b-c9a9-41ec-80bf-f583197b7f92
TCGA-13-0924-01A-01W-0421-09 OV 510dda3c-6alf-4781-972f-c9c270608c72
TCGA-13 1403 01A 01W 0494 09 OV acbc77ba-7ce0-4af2-9ab6-0c835ce33998
TCGA-13 1404 01A 01W 0494 09 OV 692e4b24-daf0-4771-b4a6-b0599f122ad8
TCGA-13 1405 01A 01W 0494 09 OV c0d1de72-4cce-4d74-93f0-29c462dc1426
TCGA-13 1411 01A 01W 0494 09 OV e254d714-ledf-4054-9ca6-9fe058a05484
TCGA-13-1412-01A-01 W-0494-09 OV 17edafe2-3eab-4bac-9d25-ed5c223b4aee
TCGA-13 1481 01A 01W 0549 09 OV f9eab025-5518-4240-bla8-19f8ff8354f0
TCGA-13-1482-01A-01W-0549-09 OV a68927d4-e827-49c9-9c3a-23ce0543261h
TCGA-13 1483 01A 01W 0549 09 OV 52280c07-44f5-4e9c-8601-7455b5b0de7a
TCGA-13 1488 01A 01W 0549 09 OV 886a8c10-63c1-4cb2-83d2-5a99bbda193d
TCGA-13 1489 01A 01W 0549 09 OV 395c1d93-7216-4c9d-bfad-26ff95fb8afe
202

CA 02908434 2015-09-30
WO 2014/168874
PCMJS2014/033185
TCGA-13 1491 01A 01W 0549 09 OV fb7d1c2b-3e87-4d05-a589-92d0e1016986
TCGA-13 1497 01A 01W 0549 09 OV 04e814c6-ea28-4ade-bc8f-a618552943da
1CGA-13 1498 01A 01W 0549 09 OV b00d9680-4099-43fe-87de-b3cc8b9e70c8
TCGA-13 1499 01A 01W 0549 09 OV b4ce07b1-677e-4a9c-8f8e-267762487692
TCGA-13-1506-01A-01W-0549-09 OV 75349542-88f8-445c-ae4a-9f44f66798a8
TCGA-13 1507 01A 01W 0549 09 OV 5423db1a-5b59-4a5b-a676-00a54570b04a
TCGA-13 1509 01A 01W 0549 09 OV 4d3fab96-bc22-48d0-a3ef-1844ad894d0f
TCGA-23-1021-01B-01W-0488-09 OV 4f14d366-4750-471f-98a1-a01934365eel
TCGA-23-1022-01A-02W-0488-09 OV 160a0e7d-315e-4de3-a7d4-928412fd909c
TCGA-23-1117-01A-02W-0488-09 OV 3a4b0c6a-1f43-437c-b715-fc50c1c0303d
TCGA-23 1118 01A 01W 0488 09 OV 00c41845-6b48-40fa-82e9-1b436e7d91c3
TCGA-23-1123-01A-01 W-0488-09 OV 22cfe2c8-5elf-4664-854d-2a7a02bf10fe
TCGA-23 1124 01A 01W 0488 09 OV 8a4061a0-77f2-4bb4-a3da-9b3d9f0314b9
TCGA-24 0966 01A 01W 0977 09 OV dc069342-661a-4012-9bda-0c67469e117c1
TCGA-24-0980-01A-01W-0421-09 OV 87d32a92-a8d2-4656-a100-798328338486
TCGA-24-0982-01A-01W-0488-09 OV 7667c0e6-e44a-448f-b118-6e2171a99b6c
TCGA-24 1103 01A 01W 0488 09 OV 47b7427c-a91a-4872-bc08-50c076a60512
TCGA-24 1104 01A 01W 0488 09 OV 9cdb7821-fe43-46cd-94f3-b9d68b9ce21f
TCGA-24 1413 01A 01W 0494 09 OV 1b2d2cde-4553-472e-82f1-8224745ac1eb
TCGA-24 1416 01A 01W 0549 09 OV 21f5e805-c064-487b-9ccd-02963e2369ff
TCGA-24 1417 01A 01W 0549 09 OV f6f43d04-a9e3-48c8-a276-3bebcaf416d7
TCGA-24 1418 01A 01W 0549 09 OV 6093bcb5-4889-4c69-9b01-e4e4278e72aa
TCGA-24-1424-01A-01W-0549-09 OV 2849 f3e8-85d8-4d42-95:36-3190bOca98fc
TCGA-24-1425-01A-02W-0553-09 OV f8d4c37d-5b4d-4f5a-8022-7da2b32cc1b0
TCGA-24-1426-01A-01W-0549-09 OV 063f8696-2c9d-4af4-a863-df10c42a5ea8
TCGA-24-1427-01A-01W-0549-09 OV 6511d3d4-722c-4702-a644-296b98e5e5c3
TCGA-24 1428 01A 01W 0549 09 OV 52866517-eddf-4d63-a121-a296d6b2d264
TCGA-24 1435 01A 01W 0549 09 OV 28d236f6-dddc-48c2-be30-b1568a4d6055
TCGA-24 1436 01A 01W 0549 09 OV adeff0f5-d2a3-41c5-a509-298002266bb
TCGA-24 1463 01A 01W 0549 09 OV c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f
TCGA-24 1464 01A 01W 0549 09 OV 01ec3cb9-c68a-4874-b396-f5e34876e04a
TCGA-24 1469 01A 01W 0553 09 OV 990c4b9d-608d-4b85-959c-5ccl2f4e10fc
1CGA-24 1470 01A 01W 0553 09 OV 1d2bf111-910b-4ce9-8638-ab992b414e65
TCGA-24 1549 01A 01W 0553 09 OV b2e252bd-895f-4b28-9367-dd527331010f
TCGA-24-1562-01A-01W-0553-09 OV 5e49bcea-9c1d-4cfd-a64c-4b84859bdda5
TCGA-24 1563 01A 01W 0553 09 OV b6c46b53-f94d-4936-9005-518c8f1c1449
TCGA-24 1616 01A 01W 0553 09 OV c464b216-9cfe-463a-b5e3-9a76cd4480c5
TCGA-25 1315 01A 01W 0494 09 OV 52f45b5e-af86-454c-be63-a56c6c21b730
TCGA-25 1316 01A 01W 0494 09 OV d75a0b16-04e4-46a3-a695-132c5ace698b
TCGA-25 1322 01A 01W 0494 09 OV 626f1798-1b15-4b01-8d8f-db19777c172e9
203

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
TCGA-AF-3913-01A-02W-1073-09 READ 4ebe7cf9-ce4f-485d-9332-ea9b536e38e2
TCGA-AG-3887-01A-01W-1073-09 READ 6d2dc015-e812-4d3f-903b-7febdcfcd2f7
'1CGA-AG 3890 01A 01W 1073 09 READ 042e9841-c106-41)23-9908-5abat407e694
TCGA-AG 3892 01A 01W 1073 09 READ 26acdae6-b0la-4dbd-b0b8-f6d97fe01808
TCGA-AG-3893-01A-01W-1073-09 READ Ofaa6d28-c01c-4847-9552-912733485610
TCGA-AG-3894-01A-01W-1073-09 READ e508d0c8-cdaf-463f-bb03-47af1bc41866
TCGA-AG-3896-01A-01W-1073-09 READ 22c7d09a-e69b-44be-8d8e-0a0cc9adt57c
TCGA-AG 3898 01A 01W 1073 09 READ cc3516ba-2941-4efa-80fc-7b5041194d52
TCGA-AG-3901-01A-01W-1073-09 RE AD 84859471-1136-4f42-ab75-b27a4ef27199
TCGA-AG-3902-01A-01W-1073-09 READ b679f02d-f48d-49eb-b245-65f341e4c181
TCGA AG 3909-01A-01W-1073-09 READ f5ece3cf-39eb-4277-8975-986e548bc1ea
l'CGA-AG 3999 01A 01W 1073 09 READ 0445426d-b9c0-4ce5-blcc-cb236d4381cf
TCGA-AG-4001-01A-02W-1073-09 READ 55075176-07a4-4183-9f8f-9f472b15a6b4
TCGA-AG-4005-01A-01W-1073-09 READ beld3bda-dela-4768-a2e4-22c07326ddc3
TCGA-AG 4007 01A 01W 1073 09 READ 6fcfdc8f-22c0-4c3a-9e46-58c0a68e818e
TCGA-AG-4008-01A-01W-1073-09 READ 83cd3c15-8eab-4d46-b9a2-36ee719f6774
TCGA-AG 4015 01A 01W 1073 09 READ cf6f8e0f-04bf-4a0d-933e-8034ba6c1607
TCGA-AG-A008-01A-01W-A005-10 RE AD 2221cfc4-b324-4329-ad37-3dd9a5adf36e
TCGA-AG-A00C-01A-01W-A005-10 READ 1a4f95be-32d3-4202-a0e7-507181b3fb86
TCGA-AG-A00H-01A-01W-A00E-09 READ fdc4c8ac-fcc2-4801-ac94-94c5d8058a9f
11CGA-AG-A00Y-01A-02W-A005-10 READ b50aeldt-ee6f-4a5e-ba4b-c962d740ab22
TCGA-AG-A011-01A READ b5dd8f49-26fc-48d9-a964-d8ebdcca9e19
TCGA-AG-A014-01A READ fb fa6lfe-4fb7-4b2a-9bf0-33140fd41873
TCGA-AG-A015-01A-01W-A005-10 READ abb751f0-c4df-4556-ac9b-adle1971cccf
TCGA-AG-A016-01A-01W-A005-10 READ f20ae301-blOb-4dfa-9169-04bc6c3d103a
TCGA-AG-A01L-01A READ b034c90b-d0bd-466a-88ba-b6 1
efd36c6c4
'ICGA-AG- A025-01A-01W-A001-09 REM) 71)5a3c33-cd13-4e4d-a1f8-
3405dah59981
TCGA-AG-A02G-01A-01W-A00E-09 READ 954527dc-8a7d-474d-b580-82199e86cb5a
TCGA-AG-A02X-01A-01W-A00E-09 READ 9f1b8919-a98c-40bd-bdad-146b1ccel4ef
TCGA-AG-A032-01A-01W-A00E-09 READ 7522eb6b-797a-4964-8aca-6d70590b5f9f
Pipeline for prediction of peptides derived from gene mutations with binding
to
personal HLA alleles: MHC-binding affinity was predicted across all possible 9-
mer and 10-
mer peptides generated from each somatic mutation and the corresponding
wildtype peptide
using NetMHCpan (version 2.4). These tiled peptides were analyzed for their
binding affinities
(IC50 nM) to each class I alleles in the patients' HLA profile. An IC50 value
of less than 150 nM
was considered a predicted strong to intermediate binder, an IC50 of 150-500
nM was
204

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
considered a predicted weak binder, while an IC50 > 500 nM was considered a
non-binder.
Experimental confirmation of predicted peptides binding to HLA molecules (IC50
< 500 nM)
was performed using a competitive MHC class I allele-binding assay and has
been described in
detail elsewhere (Cai et al. 28 and Sidney et al. 2001).
Sources of antigen: Peptides were synthesized to >95% purity (confirmed by
high
performance liquid chromatography) from New England Peptide (Gardner, MA); or
RS
Synthesis, (Louisville, KY). Peptides were reconstituted in DMSO (10 mg/ml)
and stored at ¨
80 C until use. Minigenes comprised of a sequence of 300 bp encompassing mut
or wt FNDC3B
were PCR-cloned from Pt 2's tumor into the expression vector pcDNA3.1 using
the following
primers: 5'primer: GACGTCGGATCCCACCATGGGTCCCGGAATTAAGAAAACAGAG; 3'
primer:
CCCGGGGCGGCCGCCTAATGGTGATGGTGATGGTGACATTCTAATTCTTCTCCACTG
TAAA. Minigenes were expressed in antigen-presenting target cells by
introducing 20 lug of the
plasmid into 2 million K562 cells (ATCC) stably transfected with HLA-A2 by
Amaxa
nucleofection (Solution V, Program T16, Lonza Inc; Walkersville, MD). Cells
were incubated in
RPMI media (Cellgro; Manassas, VA), supplemented with 10% fetal bovine serum
(Cellgro),
1% HEPES buffer (Cellgro), and 1% L-glutamine (Cellgro). The cells were
harvested 2 days
following nucleofection for immune assays.
Analysis of gene expression in CLL cases: previously reported microarray data
(NCI
Gene Expression Omnibus accession GSE37168) was reanalyzed. Affymetrix CEL
files were
processed using the affy package in R. The Robust Multichip Analysis (RMA)
algorithm was
used for background correction which models the observed intensities as a
mixture of
205

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
exponentially distributed signal and normally distributed noise. This was
followed by quantile
normalization across arrays to facilitate comparison of gene expression under
different
conditions. The individual probe-level was finally summarized using the median
polish approach
to get robust probeset-level values. Gene-level values were obtained by
selecting the probe with
the maximal average expression for each gene. Batch effects in the data were
removed by using
the Combat program.
Generation and detection of antigen specific T cells from patient PBMCs:
Autologous dendritic cells (DCs) were generated from immunomagnetically-
isolated CD144- cells
(Miltenyi, Auburn CA) that were cultured in RPMI (Cellgro) supplemented with
3% fetal bovine
.. serum, 1% penicillin-streptomycin (Cellgro), 1% L-glutamine and 1% HEPES
buffer in the
presence of 120 ng/ml GM-CSF and 70 ng/ml IL-4 (R&D Systems, Minneapolis, MN).
On days
three and five, additional GM-CSF and IL-4 were added. On day six, cells were
exposed to
30pg/m1 Poly I:C (Sigma Aldrich, St Louis, MO) to undergo maturation (for 48
hours), in
addition to adding IL-4 and GM-CSF. CD19- B cells were isolated from patient
PBMCs by
inamunomagnetic selection (CD19+ microbeads; Miltenyi, Auburn, CA), and seeded
at lx106
cells/well in a 24-well plate. B cells were cultured in B cell media (Iscoves
modified Dulbecco
medium (IMDM; Life Technologies, Woburn, MA), supplemented with 10% human AB
serum
(GemCell, Sacramento, CA), 5pg/mL insulin (Sigma Chemical, St Louis, MO), 15
pg/mL
gentamicin, IL-4 (2ng/ml, R&D Systems, Minneapolis, MN) arid CD4OL-Tri
(lpg/m1). OA0L-
Tri was replenished every 3-4 days. For some experiments, CD4OL-Tri activated
and expanded
CD19 lB cells were used as APCs.
206

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Generation of antigen-specific T cells from patient PBMCs: To generate peptide-
reactive T cells from CLL patients, immunomagnetically selected CD8+ T cells
(5x106/well)
from pre- and post-transplant PBMCs (CD8+ Microbeads, Miltenyi, Auburn, CA)
were cultured
with autologous peptide pool-pulsed DCs (at 40:1 ratio) or CD4OL-Tri-activated
irradiated B
cells (at 4:1 ratio) respectively, in complete medium supplemented with 10%
FBS and 5-10
ng/mL IL-7, IL-12 and IL-15. APCs were pulsed for 3 hours with peptide pools
(10 i.fiVI/
peptide/pool). CD8+ T cells were re-stimulated weekly (for 1-3 weeks, starting
on day 7) with
APCs.
Detection of antigen-specific T cells: T cell specificity against peptide
pools was tested
by IFN-y ELISPOT assay, 10 days following 2nd and 4th stimulations. IFN-
'yrelease was detected
using test and control peptide-pulsed CD4OL-activated B cells (50,000
cells/well) co-incubated
with 50,000 CD8'- T cells/well (Millipore, Billerica, MA) for 24 hours on
ELISPOT plate. IFN-y
was detected using capture and detection antibodies, as directed (Mabtech AB,
Mariemont, OH),
and imaged (ImmunoSpot Series Analyzer; Cellular Technology, Cleveland, OH).
To test T cell
reactivity dependence on MHC class I, ELISPOT plates were first coated with
APCs co-
incubated with class I blocking antibody (W6/32) for 2 hours at 37 C, prior to
introduction of T
cells into the wells. MHC class I tetramer was used to test specificity of T
cells where indicated
(Emory University, Atlanta GA). For tetramer staining, 5x105 cells were
incubated for 60
minutes at 4 C with 11.1g/mL PE-labeled tetramer, and then incubated with the
addition of anti-
CD3-FITC and anti-CD8-APC antibodies (BD Biosciences, San Diego CA) for
another 30
minutes at 4 C. A minimum of 100,000 events were acquired per sample.
Secretion of GM-CSF
and IL-2 from cultured CD8+ T cells was detected by analysis of culture
supernatants using a
Luminex multiplex bead-based technology, per the manufacturer's
recommendations (EMD
207

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Millipore, Billerica, MA). In brief, fluorescent-labeled microspheres were
coated with specific
cytokine capture antibodies. After incubation with the culture supernatant
sample, captured
cytokines were detected by a biotinylated detection antibody followed by a
streptavidin-PE
conjugate and median fluorescence intensity (MFI) was measured (Luminex 200
Bead Array
instrument; Luminex Corporation, Austin TX). Based on a standard curve,
cytokine levels were
calculated in the Bead View Software program (Upstate, EMD Millipore,
Billerica, MA). For
detection and quantitation of TCR VI3 clonotypes, mut-FNDC3B specific T cells
were enriched
from Pt 2's T cell lines using the IFN-y secretion assay (Miltenyi, Auburn,
CA) according to the
manufacturer's instructions and as previously described.
Statistical considerations: Two-way ANOVA models were constructed for T cells
reactivity against mut vs wt peptide in the form of IFN-gamma, GM-CSF, and IL-
2 release and
included concentration and mutational status as fixed effects along with an
interaction term as
appropriate. P-values for these models were adjusted for multiple comparisons
post-hoc using
the Tukey method. For normalized comparisons of IFN-gamma, a t-test was
performed to test the
hypothesis that the normalized ratio equaled one. For other comparisons of
continuous measures
between groups, a Welch t-test was used. All P-values reported are two-sided
and considered
significant at the 0.05 level with appropriate adjustment for multiple
comparisons. Analysis was
performed in SAS v9.2.
Detection and quantitation of TCR VI3 clonotypes: To detect mut-FNDC3B
specific
TCR VI3. a two-step nested PCR from peptide-specific IFN-y enriched T cell
populations was
performed. In short, the dominant Vi3 subfamily was identified among the 24
known vp
subfamilies. First, 5 pools of vp forward primers (pool 1: vp 1-5.1; pool 2:
vp 5.2-9; pool 3:
208

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
V13 10-13.2; pool 4: VI3 14-19; and pool 5: vp 20, 22-25) were generated. RNA
extracted from
the T cell clones (QIAamp RNA Blood Mini-kit; Qiagen, Valencia, CA), was
reverse transcribed
into cDNA (Superscript, GIBCO BRL, Gaithersburg, MD) using random hexamers,
and PCR-
amplified in five separate 20 p,1 volume reactions. Second, T cell clone-
derived cDNA was re-
amplified, with each of the 5 individual primers contained within a positive
pool together with a
FAM-conjugated CI3 reverse (internal) primer. Subsequently, 4 p,1 of this PCR
product was
amplified with 1 ill of the clone CDR3 region-specific primer and probe, and
10 ill of Taqman
Fast Universal PCR Master Mix (Applied Biosystems. Foster City, CA) in a total
volume of 20
1.11. The PCR amplification conditions were: 95 C for 20 minutes x 1 cycle,
and 40 cycles of
95 C for 3 seconds followed by 60 C for 30 seconds (7500 Fast Real-time PCR
cycler; Applied
Biosystems, Foster City, CA). Test transcripts were quantified relative to S/8
ribosomal RNA
transcripts by calculating 2A(S18 rRNA CT-target CT) as described previously.
Detection of molecular tumor burden: The clonotypic IgH sequence of Pt 2 was
identified using a panel of VH-specific PCR primers, as previously described.
Based on this
sequence, a quantitative Taqman PCR assay was designed such that a sequence-
specific probe
was located in the region of junctional diversity (Applied Biosystems; Foster
City, CA). This
Taqman assay was applied to cDNA from tumor. All PCR reactions consisted of:
50 C for 1
minute xl cycle, 95 C for 10 minutes xl cycle, and 40 cycles of 95 C for 15
seconds followed by
60 C for 1 minute. All reactions were performed using a 7500 Fast Real-time
PCR cycler
(Applied Biosystems, Foster City, CA). Test transcripts were quantified
relative to GAPDH.
209

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
REFERENCES
Zhang GL, Ansari HR, Bradley P, et al. Machine learning competition in
immunology -
Prediction of HLA class I binding peptides. J Immunol Methods. Nov 30
2011;374(1-
2):1-4.
Kawai T, Akira S. TLR signaling. Seminars in immunology. Feb 2007;19(1):24-32.
Adams S. Toll-like receptor agonists in cancer therapy. Immunotherapy. Nov
2009;1(6):949-964.
Cheever MA. Twelve immunotherapy drugs that could cure cancers. Immunological
reviews.
Apr 2008;222:357-368.
Bogunovic D, Manches 0, Godefroy E, et al. TLR4 engagement during TLR3-induced
proinflammatory signaling in dendritic cells promotes IL-10-mediated
suppression of
antitumor immunity. Cancer Res. Aug 15 2011;71(16):5467-5476.
Stahl-Hennig C, Eisenblattef M. Jasny E, et al. Synthetic double-stranded RNAs
are adjuvants
for the induction of T helper 1 and humoral immune responses to human
papillomavirus
in rhesus macaques. PLoS pathogens. Apr 2009;5(4):e1000373.
Boscardin SB, Hafalla JC. Masilamani RF, et al. Antigen targeting to dendritic
cells elicits long-
lived T cell help for antibody responses. The Journal of experimental
medicine. Mar 20
2006;203(3):599-606.
Soares H, Waechter H. Glaichenhaus N, et al. A subset of dendritic cells
induces CD4+ T cells to
produce IFN-gamma by an IL-12-independent but CD70-dependent mechanism in
vivo.
The Journal of experimental medicine. May 14 2007;204(5):1095-1106.
Trumpfheller C, Caskey M, Nchinda G, et al. The microbial mimic poly IC
induces durable and
protective CD4+ T cell immunity together with a dendritic cell targeted
vaccine. Proc
Natl Acad Sci U S A. Feb 19 2008;105(7):2574-2579.
Trumpfheller C, Finke JS, Lopez CB, et al. Intensified and protective CD4+ T
cell immunity in
mice with anti-dendritic cell HIV gag fusion antibody vaccine. The Journal of
experimental medicine. Mar 20 2006;203(3):607-617.
Salem ML, Kadima AN, Cole DJ, Gillanders WE. Defining the antigen-specific T-
cell response
to vaccination and poly(I:C)/TLR3 signaling: evidence of enhanced primary and
memory
CD8 T-cell responses and antitumor immunity. J Immunother. May-Jun
2005;28(3):220-
228.
210

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Tough DF, BOITOW P, Sprent J. Induction of bystander T cell proliferation by
viruses and type I
interferon in vivo. Science. Jun 28 1996;272(5270):1947-1950.
Thu X, Nishimura F, Sasaki K, et al. Toll like receptor-3 ligand poly-ICLC
promotes the efficacy
of peripheral vaccinations with tumor antigen-derived peptide epitopes in
murine CNS
tumor models. Journal of translational medicine. 2007;5:10.
Flynn BJ, Kastenmuller K, Wille-Reece U, et al. Immunization with HIV Gag
targeted to
dendritic cells followed by recombinant New York vaccinia virus induces robust
T-cell
immunity in nonhuman primates. Proc Natl Acad Sci U S A. Apr 26
2011;108(17):7131-
7136.
Gaudier D, Therrien R, Kettaf N, et al. Yellow fever vaccine induces
integrated multilineage and
polyfunctional immune responses. The Journal of experimental medicine. Dec 22
2008;205(13):3119-3131.
Caskey M, Lefebvre F, Filah-Mouhim A, et al. Synthetic double-stranded RNA
induces innate
immune responses similar to a live viral vaccine in humans. The Journal of
experimental
medicine. Nov 21 2011;208(12):2357-2366.
Sabbatini P, Tsuji T, Ferran L, et al. Phase I trial of overlapping long
peptides from a tumor self-
antigen and poly-ICLC shows rapid induction of integrated immune response in
ovarian
cancer patients. Clinical cancer research : an official journal of the
American Association
for Cancer Research. Dec 1 2012;18(23):6497-6508.
Robinson RA, DeVita VT, Levy HB, Baron S, Hubbard SP, Levine AS. A phase I-II
trial of
multiple-dose polyriboinosic-polyribocytidylic acid in patients with leukemia
or solid
tumors. Journal of the National Cancer Institute. Sep 1976:57(3):599-602.
Siegel R, Naishadham D, Jemal A. Cancer statistics, 2013. CA: a cancer journal
for clinicians.
Jan 2013;63W:11-30.
Balch CM. Gershenwald JE, Soong SJ, et al. Final version of 2009 AJCC melanoma
staging and
classification. Journal of clinical oncology: official journal of the American
Society of
Clinical Oncology. Dec 20 2009;27(36):6199-6206.
Eggermont AM, Suciu S, Testori A, et al. Ulceration and stage are predictive
of interferon
efficacy in melanoma: results of the phase III adjuvant trials EORTC 18952 and
EORTC
18991. Eur J Cancer. Jan 2012;48(2):218-225.
211

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Sosman JA, Moon J, Tuthill RJ, et al. A phase 2 trial of complete resection
for stage IV
melanoma: results of Southwest Oncology Group Clinical Trial S9430. Cancer.
Oct 15
2011;117(20):4740-4706.
Flaherty KT, Hodi FS, Fisher DE. From genes to drugs: targeted strategies for
melanoma. Nat
Rev Cancer. May 2012;12(5):349-361.
Mocellin S, Pasquali S, Rossi CR, Nitti D. Interferon alpha adjuvant therapy
in patients with
high-risk melanoma: a systematic review and meta-analysis. Journal of the
National
Cancer Institute. Apr 7 2010;102(7):493-501.
Pirard D, Heenen M, Melot C, Vereecken P. Interferon alpha as adjuvant
postsurgical treatment
of melanoma: a meta-analysis. Dermatology. 2004;208(1):43-48.
Wheatley K, Ives N, Hancock B, Gore M, Eggermont A, Suciu S. Does adjuvant
interferon-alpha
for high-risk melanoma provide a worthwhile benefit? A meta-analysis of the
randomised
trials. Cancer treatment reviews. Aug 2003;29(4):241-252.
Buckwalter MR, Srivastava PK. "It is the antigen(s), stupid" and other lessons
from over a
decade of vaccitherapy of human cancer. Seminars in immunology. Oct
2008;20(5):296-
300.
Baurain JF, Colau D. van Baren N, et al. High frequency of autologous anti-
melanoma CTL
directed against an antigen generated by a point mutation in a new helicase
gene. J
Immunol. Jun 1 2000;164(11):6057-6066.
Chiari R, Foury F, De Plaen E, Baurain JF, Thonnard J, Coulie PG. Two antigens
recognized by
autologous cytolytic T lymphocytes on a melanoma result from a single point
mutation in
an essential housekeeping gene. Cancer Res. Nov 15 1999:59(22):5785-5792.
Huang J, El-Gamil M, Dudley ME, Li YF, Rosenberg SA, Robbins PF. T cells
associated with
tumor regression recognize frameshifted products of the CDKN2A tumor
suppressor
gene locus and a mutated HLA class I gene product. J Immunol. May 15
2004;172(10):6057-6064.
Karanikas V, Colau D, Baurain JF, et al. High frequency of cytolytic T
lymphocytes directed
against a tumor-specific mutated antigen detectable with HLA tetramers in the
blood of a
lung carcinoma patient with long survival. Cancer Res. May 1 2001;61(9):3718-
3724.
212

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Lennerz V, Fatho M, Gentilini C, et al. The response of autologous T cells to
a human melanoma
is dominated by mutated neoantigens. Proc Natl Acad Sci U S A. Nov 1
2005;102(44):16013-16018.
Zorn E, Hercend T. A natural cytotoxic T cell response in a spontaneously
regressing human
melanoma targets a neoantigen resulting from a somatic point mutation. Eur J
Immunol.
Feb 1999;29(2):592-601.
Kannan S, Neelapu SS. Vaccination strategies in follicular lymphoma. Current
hematologic
malignancy reports. Oct 2009;4(4):189-195.
Kenter GG, Welters MJ, Valentijn AR, et al. Phase I immunotherapeutic trial
with long peptides
spanning the E6 and E7 sequences of high-risk human papillomavirus 16 in end-
stage
cervical cancer patients shows low toxicity and robust immunogenicity.
Clinical cancer
research: an official journal of the American Association for Cancer Research.
Jan 1
2008;14(1):169-177.
Kenter GG, Welters MJ, Valentijn AR, et al. Vaccination against HPV-16
oncoproteins for
vulvar intraepithelial neoplasia. The New England journal of medicine. Nov 5
2009;361(19):1838-1847.
Welters MJ, Kenter GG, Piersma SJ, et al. Induction of tumor-specific CD4+ and
CD8+ T-cell
immunity in cervical cancer patients by a human papillomavirus type 16 E6 and
E7 long
peptides vaccine. Clinical cancer research : an official journal of the
American
Association for Cancer Research. Jan 1 2008;14(1):178-187.
Lundegaard C, Lund 0, Nielsen M. Prediction of epitopes using neural network
based methods. J
Immunol Methods. Nov 30 2011;374(1-2):26-34.
Schreiber RD, Old LJ, Smyth MJ. Cancer immunoediting: integrating immunity's
roles in cancer
suppression and promotion. Science. Mar 25 2011;331(6024):1565-1570.
Berger, M. et al. Melanoma genome sequencing reveals frequent PREX2 mutations.
Nature 485,
502-6 (2012).
Carter, SL. et al. Absolute quantification of somatic DNA alterations in human
cancer. Nat
Biotechnol 30, 413-21 (2012).
Chapman, M.A. et al. Initial genome sequencing and analysis of multiple
myeloma. Nature 471,
467-72 (2011).
213

CA 02908434 2015-09-30
WO 2014/168874 PCMJS2014/033185
Cibulskis, K. et al. ContEst: estimating cross-contamination of human samples
in next-
generation sequencing data. Bioinformatics 27, 2601-2 (2011).
Cibulskis, K. et al. Sensitive detection of somatic point mutations in impure
and heterogeneous
cancer samples. Nature Biotech (2013) Feb 10. doi: 10.1038/nbt.2514. [Epub
ahead of
print].
DeLuca, DS. et al. RNA-SeQC: RNA-seq metrics for quality control and process
optimization.
Bioinformatics 28, 1530-2 (2012).
DePristo, M. et al. A framework for variation discovery and genotyping using
next-generation
DNA sequencing data. Nature Genetics 43, 491-498 (2011).
Landau, DA. et al. Evolution and impact of subclonal mutations in chronic
lymphocytic
leukemia. Cell 152, 714-26 (2013).
Langmead, B. et al. Ultrafast and memory-efficient alignment of short DNA
sequences to the
human genome. Genome Biology 10, R25 (2009).
Li, B. et al. RSEM: accurate transcript quantification from RNA-Seq data with
or without a
reference genome. BMC Bioinformatics 12, 323 (2011).
Li, H. et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics
25, 2078-9
(2009).
Li H. and Durbin R. Fast and accurate short read alignment with Burrows-
Wheeler Transform.
Bioinformatics 25, 1754-60 (2009).
McKenna, A. et al. The Genome Analysis Toolkit: a MapReduce framework for
analyzing next-
generation DNA sequencing data. Genome Res 20, 1297-303 (2010).
Robinson, JT. et al. Integrative genomics viewer. Nature Biotech 29, 24-26
(2011).
Stransky, N. et al. The mutational landscape of head and neck squamous cell
carcinoma. Science
333, 1157-60 (2011).
Garraway, L.A. and Lander, E. S, Lessons from the cancer genome. Cell. 153, 17-
37 (2013).
Lundegaard, C. et al. Prediction of epitopes using neural network based
methods. J Immunol
Methods. 374, 26-34 (2011).
Sette, A. et al., The relationship between class I binding affinity and
immunogenicity of potential
cytotoxic T cell epitopes. J Immunol. 153, 5586-5592 (1994).
214

CA 02908434 2015-09-30
WO 2014/168874 PCT/US2014/033185
Lu, Y. C. et al., Mutated regions of nucleophosmin 1PPP1R3B Is Recognized by T
Cells Used
To Treat a Melanoma Patient Who Experienced a Durable Complete Tumor
Regression.
J Immunol. 190, 6034-6042 (2013).
Sykulev, Y. et al., Evidence that a single peptide-MHC complex on a target
cell can elicit a
cytolytic T cell response. Immunity. 4, 565-571 (1996).
Carter. S. L. et al., Absolute quantification of somatic DNA alterations in
human cancer. Nat.
Biotechnology 30: 413-21 (2012).
Sidney, J. et al., HLA class I supertypes: a revised and updated
classification. BMC Immunol, 9,
1 (2008).
Comprehensive genomic characterization of squamous cell lung cancers. Nature.
489, 519-525
(2012).
Ding, L. et al., Somatic mutations affect key pathways in lung adenocarcinoma.
Nature. 455,
1069-1075 (2008).
Stransky. N. et al., The mutational landscape of head and neck squamous cell
carcinoma. Science
333, 1157-1160 (2011).
Comprehensive molecular characterization of human colon and rectal cancer.
Nature. 487, 330-
337 (2012).
Comprehensive genomic characterization defines human glioblastoma genes and
core pathways.
Nature. 455, 1061-1068 (2008).
Integrated genomic analyses of ovarian carcinoma. Nature. 474, 609-615 (Jun
30, 2011).
Comprehensive molecular characterization of clear cell renal cell carcinoma.
Nature. 499, 43-49
(2013).
Genomic and epigenomic landscapes of adult de novo acute myeloid leukemia. N
Engl J Med.
368, 2059-2074 (2013).
Comprehensive molecular portraits of human breast tumours. Nature. 490, 61-70
(2012).
Other Embodiments
From the foregoing description, it will be apparent that variations and
modifications may
be made to the invention described herein to adopt it to various usages and
conditions. Such
embodiments are also within the scope of the following claims.
215

The recitation of a listing of elements in any definition of a variable herein
includes
definitions of that variable as any single element or combination (or sub-
combination) of listed
elements. The recitation of an embodiment herein includes that embodiment as
anysingle
embodiment or in combination with any other embodiments or portions thereof.
216
Date ecue/Date Received 2020-10-09

?2908434 Summary - Canadian Patents Database (2025)
Top Articles
Latest Posts
Recommended Articles
Article information

Author: Van Hayes

Last Updated:

Views: 5873

Rating: 4.6 / 5 (66 voted)

Reviews: 81% of readers found this page helpful

Author information

Name: Van Hayes

Birthday: 1994-06-07

Address: 2004 Kling Rapid, New Destiny, MT 64658-2367

Phone: +512425013758

Job: National Farming Director

Hobby: Reading, Polo, Genealogy, amateur radio, Scouting, Stand-up comedy, Cryptography

Introduction: My name is Van Hayes, I am a thankful, friendly, smiling, calm, powerful, fine, enthusiastic person who loves writing and wants to share my knowledge and understanding with you.